PHPT1 (NM_014172) Human 3' UTR Clone

CAT#: SC202457

3' UTR clone of phosphohistidine phosphatase 1 (PHPT1) transcript variant 3 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name PHPT1 (NM_014172) Human 3' UTR Clone
Vector pMirTarget
Synonyms CGI-202; HEL-S-132P; HSPC141; PHP; PHP14
ACCN NM_014172
Insert Size 189 bp
Sequence Data
>SC202457 3' UTR clone of NM_014172
The sequence shown below is from the reference sequence of NM_014172. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GCTAACGACGGCTACTGAGCACTCCCAGCCCGGGGCCTGCTGCCTCCAGCAGCCACTTCAGAGCCCCCGC
CTTTGCCTGCACTCCTCTTGCAGGGCTGGCCCTGCCTGCTCCTGCGGCAGCCTCTGGTGACGTGCTGTCC
ACCAGGCCTTGGAGACAGGCTAGCCTGGCCACAGAATTAAACGTGTTGC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_014172.4
Synonyms CGI-202; HEL-S-132P; HSPC141; PHP; PHP14
Summary This gene encodes an enzyme that catalyzes the reversible dephosphorylation of histidine residues in proteins. It may be involved in the dephosphorylation of G-beta and ATP citrate lyase and in negatively regulating CD4 T lymphocytes by dephosphorylation and inhibition of KCa3.1 channels. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
Locus ID 29085
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...