Myosin (MYL6) (NM_021019) Human 3' UTR Clone

CAT#: SC202514

3' UTR clone of myosin light chain 6 alkali smooth muscle and non-muscle (MYL6) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Myosin (MYL6) (NM_021019) Human 3' UTR Clone
Vector pMirTarget
Synonyms ESMLC; LC17; LC17-GI; LC17-NM; LC17A; LC17B; MLC-3; MLC1SM; MLC3NM; MLC3SM
ACCN NM_021019
Insert Size 239 bp
Sequence Data
>SC202514 3’UTR clone of NM_021019
The sequence shown below is from the reference sequence of NM_021019. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCGTTTGTGAGGCATATCCTGTCGGGGTGACGGGCCCATGGGGCGGAGCTCGTCCGCATGGTGCTGAAT
GGCTGAGGACCTTCCCAGTCTCCCCAGAGTCCGTGCCTTTCCCTGTGTGAATTTTGTATCTAGCCTAAA
GTTTCCCTAGGCTTTCTTGTCTCAGCAACTTTCCCATCTTGTCTCTCTTGGATGATGTTTGCCGTCAGC
ATTCACCAAATAAACTTGCTCTCTGGGCCCTC
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_021019.5
Synonyms ESMLC; LC17; LC17-GI; LC17-NM; LC17A; LC17B; MLC-3; MLC1SM; MLC3NM; MLC3SM
Summary Myosin is a hexameric ATPase cellular motor protein. It is composed of two heavy chains, two nonphosphorylatable alkali light chains, and two phosphorylatable regulatory light chains. This gene encodes a myosin alkali light chain that is expressed in smooth muscle and non-muscle tissues. Genomic sequences representing several pseudogenes have been described and two transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Locus ID 4637
MW 8.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...