SIPA1 (NM_153253) Human 3' UTR Clone

CAT#: SC202529

3' UTR clone of signal-induced proliferation-associated 1 (SIPA1) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name SIPA1 (NM_153253) Human 3' UTR Clone
Vector pMirTarget
Synonyms SPA1
ACCN NM_153253
Insert Size 227 bp
Sequence Data
>SC202529 3’UTR clone of NM_153253
The sequence shown below is from the reference sequence of NM_153253. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTGGGCTCACCCACCGCCGACCTGGCCTGAGCCGTCTGGAACCACCTGGGCCCCTGAGGGCACTGTGGT
CACACTGGGCCCTCCTCAGGAACTCTCCCTGCGCAGAGGCGTGTCTTAGCACTGCCCCCCTCCCTAGCC
CCTTATTTGGTGGCGGAAGTGGCCTCCACCCCTTCCCTGTTTGTAAATATTCTGTGGAGAAAAGAGGAC
TTCAGGGAGTAAAAAAGCCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_153253.30
Synonyms SPA1
Summary The product of this gene is a mitogen induced GTPase activating protein (GAP). It exhibits a specific GAP activity for Ras-related regulatory proteins Rap1 and Rap2, but not for Ran or other small GTPases. This protein may also hamper mitogen-induced cell cycle progression when abnormally or prematurely expressed. It is localized to the perinuclear region. Two alternatively spliced variants encoding the same isoform have been characterized to date. [provided by RefSeq, Jul 2008]
Locus ID 6494
MW 8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...