PVRL1 (NECTIN1) (NM_203286) Human 3' UTR Clone

CAT#: SC202578

3' UTR clone of poliovirus receptor-related 1 (herpesvirus entry mediator C) (PVRL1) transcript variant 3 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name PVRL1 (NECTIN1) (NM_203286) Human 3' UTR Clone
Vector pMirTarget
Synonyms CD111; CLPED1; ED4; HIgR; HV1S; HVEC; nectin-1; OFC7; PRR; PRR1; PVRL1; PVRR; PVRR1; SK-12
ACCN NM_203286
Insert Size 233 bp
Sequence Data
>SC202578 3’UTR clone of NM_203286
The sequence shown below is from the reference sequence of NM_203286. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AAAGGGAGGACAAGAGCTAGGATGTTCTGAGGAGAGACTTCACCTGGGACGTGAAAGGAGCATGGGCTT
GATGTCAGACAGCTGTGACCCTGGACAGGGCCCCCCCCACCATCTGTAAAACGGGGACAGTATGATGTA
CCTTGAAGGGCTGTTGTCAGAATTCTACGTGATGTAAGTCAAGCACCTAGCACAGATCAGTCTGTCAAT
AAATGGCCAATGTTCCGTGATTATTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_203286.2
Synonyms CD111; CLPED1; ED4; HIgR; HV1S; HVEC; nectin-1; OFC7; PRR; PRR1; PVRL1; PVRR; PVRR1; SK-12
Summary This gene encodes an adhesion protein that plays a role in the organization of adherens junctions and tight junctions in epithelial and endothelial cells. The protein is a calcium(2+)-independent cell-cell adhesion molecule that belongs to the immunoglobulin superfamily and has 3 extracellular immunoglobulin-like loops, a single transmembrane domain (in some isoforms), and a cytoplasmic region. This protein acts as a receptor for glycoprotein D (gD) of herpes simplex viruses 1 and 2 (HSV-1, HSV-2), and pseudorabies virus (PRV) and mediates viral entry into epithelial and neuronal cells. Mutations in this gene cause cleft lip and palate/ectodermal dysplasia 1 syndrome (CLPED1) as well as non-syndromic cleft lip with or without cleft palate (CL/P). Alternative splicing results in multiple transcript variants encoding proteins with distinct C-termini. [provided by RefSeq, Oct 2009]
Locus ID 5818
MW 8.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...