ATP5E (NM_001001977) Human 3' UTR Clone

CAT#: SC202674

3' UTR clone of ATP synthase H+ transporting mitochondrial F1 complex epsilon subunit (ATP5E) nuclear gene encoding mitochondrial protein for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name ATP5E (NM_001001977) Human 3' UTR Clone
Vector pMirTarget
Synonyms ATPE; MGC104243
ACCN NM_001001977
Insert Size 256 bp
Sequence Data
>SC202674 3’UTR clone of NM_001001977
The sequence shown below is from the reference sequence of NM_001001977. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GTAAAAATTGTGAAAGTAAAGAAGGAATAATCTACCCTGACTAAAGCTTGAAATGCTACATTTCCAAGG
TGAAGATGTGTGGGCACATGTTATGGCAGATTGAAAAGGATCTCATTCCATGGGAAAAAAAAAAATCCT
GTCTTGTTCATAAATTGACAATGTCAATAAATTGAAATATGGTTCACTGTTACTCTTGAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001001977.1
Synonyms ATPE; MGC104243
Summary This gene encodes a subunit of mitochondrial ATP synthase. Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. ATP synthase is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, comprising the proton channel. The catalytic portion of mitochondrial ATP synthase consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled with a stoichiometry of 3 alpha, 3 beta, and a single representative of the other 3. The proton channel consists of three main subunits (a, b, c). This gene encodes the epsilon subunit of the catalytic core. Two pseudogenes of this gene are located on chromosomes 4 and 13. Read-through transcripts that include exons from this gene are expressed from the upstream gene SLMO2.[provided by RefSeq, Mar 2011]
Locus ID 514
MW 10.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...