Glutathione Peroxidase 1 (GPX1) (NM_000581) Human 3' UTR Clone

CAT#: SC202736

3' UTR clone of glutathione peroxidase 1 (GPX1) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Cited in 1 publication.

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Glutathione Peroxidase 1 (GPX1) (NM_000581) Human 3' UTR Clone
Vector pMirTarget
Synonyms GPXD; GSHPX1
ACCN NM_000581
Insert Size 242 bp
Sequence Data
>SC202736 3’UTR clone of NM_000581
The sequence shown below is from the reference sequence of NM_000581. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTGCTGTCTCAAGGGCCCAGCTGTGCCTAGGGCGCCCCTCCTACCCCGGCTGCTTGGCAGTTGCAGTGC
TGCTGTCTCGGGGGGGTTTTCATCTATGAGGGTGTTTCCTCTAAACCTACGAGGGAGGAACACCTGATC
TTACAGAAAATACCACCTCGAGATGGGTGCTGGTCCTGTTGATCCCAGTCTCTGCCAGACCAAGGCGAG
TTTCCCCACTAATAAAGTGCCGGGTGTCAGCAGAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000581.4
Synonyms GPXD; GSHPX1
Summary The protein encoded by this gene belongs to the glutathione peroxidase family, members of which catalyze the reduction of organic hydroperoxides and hydrogen peroxide (H2O2) by glutathione, and thereby protect cells against oxidative damage. Other studies indicate that H2O2 is also essential for growth-factor mediated signal transduction, mitochondrial function, and maintenance of thiol redox-balance; therefore, by limiting H2O2 accumulation, glutathione peroxidases are also involved in modulating these processes. Several isozymes of this gene family exist in vertebrates, which vary in cellular location and substrate specificity. This isozyme is the most abundant, is ubiquitously expressed and localized in the cytoplasm, and whose preferred substrate is hydrogen peroxide. It is also a selenoprotein, containing the rare amino acid selenocysteine (Sec) at its active site. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. This gene contains an in-frame GCG trinucleotide repeat in the coding region, and three alleles with 4, 5 or 6 repeats have been found in the human population. The allele with 4 GCG repeats has been significantly associated with breast cancer risk in premenopausal women. Alternatively spliced transcript variants have been found for this gene. Pseudogenes of this locus have been identified on chromosomes X and 21. [provided by RefSeq, Aug 2017]
Locus ID 2876
MW 8.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Documents

Customer Reviews 
Loading...