Laminin 2 alpha (LAMA2) (NM_001079823) Human 3' UTR Clone

CAT#: SC202810

3' UTR clone of laminin alpha 2 (LAMA2) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Laminin 2 alpha (LAMA2) (NM_001079823) Human 3' UTR Clone
Vector pMirTarget
Synonyms LAMM; MDC1A
ACCN NM_001079823
Insert Size 249 bp
Sequence Data
>SC202810 3’UTR clone of NM_001079823
The sequence shown below is from the reference sequence of NM_001079823. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GTTCAACCTGTATCATGCCCAGCCAACTAATAAAAATAAGTGTAACCCCAGGAAGAGTCTGTCAAAACA
AGTATATCAAGTAAAACAAACAAATATATTTTACCTATATATGTTAATTAAACTAATTTGTGCATGTAC
ATAGAATTCTTTCTGTATTCAGATGGTGCTAATTCAGACTCCAGACTGAATTTTAATTCAAGTTCTTTC
TCAAGTCTATAAATAATATTAAACTGATTATTTCATTCTAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001079823.2
Synonyms LAMM; MDC1A
Summary Laminin, an extracellular protein, is a major component of the basement membrane. It is thought to mediate the attachment, migration, and organization of cells into tissues during embryonic development by interacting with other extracellular matrix components. It is composed of three subunits, alpha, beta, and gamma, which are bound to each other by disulfide bonds into a cross-shaped molecule. This gene encodes the alpha 2 chain, which constitutes one of the subunits of laminin 2 (merosin) and laminin 4 (s-merosin). Mutations in this gene have been identified as the cause of congenital merosin-deficient muscular dystrophy. Two transcript variants encoding different proteins have been found for this gene. [provided by RefSeq, Jul 2008]
Locus ID 3908
MW 9.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...