CSRP2 (NM_001321) Human 3' UTR Clone

CAT#: SC202832

3' UTR clone of cysteine and glycine-rich protein 2 (CSRP2) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name CSRP2 (NM_001321) Human 3' UTR Clone
Vector pMirTarget
Synonyms CRP2; LMO5; SmLIM
ACCN NM_001321
Insert Size 273 bp
Sequence Data
>SC202832 3’UTR clone of NM_001321
The sequence shown below is from the reference sequence of NM_001321. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGAGCAGGGGCTCTTGTTCATGCCCAGTAAGATGTAAACCCTGAACTAAACATCACACACTGAGAATCT
CTTCATAATCTAGGCACAGATAATCTTTAACACTAAACTACTGTGAAATTCTACCAGCATTAAGTACTG
TATATCGCCCTGTACTTGGATAGGCTGGCTAACTCGTAGGAAGAGAGCACTGTATGGTATCCTTTTGCT
TTATTCACCAGCATTTTGGGGGAACATTTCTTTTACATTTTAAATAAAACTTCAGCTTGATTTGGG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001321.3
Synonyms CRP2; LMO5; SmLIM
Summary CSRP2 is a member of the CSRP family of genes, encoding a group of LIM domain proteins, which may be involved in regulatory processes important for development and cellular differentiation. CRP2 contains two copies of the cysteine-rich amino acid sequence motif (LIM) with putative zinc-binding activity, and may be involved in regulating ordered cell growth. Other genes in the family include CSRP1 and CSRP3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
Locus ID 1466
MW 10.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...