SGLT2 (SLC5A2) (NM_003041) Human 3' UTR Clone

CAT#: SC202921

3' UTR clone of solute carrier family 5 (sodium/glucose cotransporter) member 2 (SLC5A2) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Cited in 4 publications.

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name SGLT2 (SLC5A2) (NM_003041) Human 3' UTR Clone
Vector pMirTarget
Synonyms SGLT2
ACCN NM_003041
Insert Size 264 bp
Sequence Data
>SC202921 3’UTR clone of NM_003041
The sequence shown below is from the reference sequence of NM_003041. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCCGTGTTCCTCTGGGGCTTCTATGCCTAAGACCAACTGCGTTGGACACCATAAGCCACAGCCTCACAG
GAAGTGGGGGTGAGGAGCCTGCGGTGCTCCCCAGAAAAGGGGAAGGGGCAGTGGGGTGAGAAGGTCCTG
GCTCCCCTTCTCCCGGCCTTCCTCTGCCTGGGGCCCACTGCATCTGATTGGCAGTCACTTCCCATGAGG
GCCTGGCCCACCCGCTGCAGTTGCCCTAAGGAAAAATAAAGCTGCCTTTCCCCTGTC
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_003041.4
Synonyms SGLT2
Summary This gene encodes a member of the sodium glucose cotransporter family which are sodium-dependent glucose transport proteins. The encoded protein is the major cotransporter involved in glucose reabsorption in the kidney. Mutations in this gene are associated with renal glucosuria. Two transcript variants, one protein-coding and one not, have been found for this gene. [provided by RefSeq, Feb 2015]
Locus ID 6524
MW 9.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (4)

Documents

Customer Reviews 
Loading...