BEX1 (NM_018476) Human 3' UTR Clone

CAT#: SC202995

3' UTR clone of brain expressed X-linked 1 (BEX1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name BEX1 (NM_018476) Human 3' UTR Clone
Vector pMirTarget
Synonyms BEX2; HBEX2; HGR74-h
ACCN NM_018476
Insert Size 276 bp
Sequence Data
>SC202995 3’UTR clone of NM_018476
The sequence shown below is from the reference sequence of NM_018476. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CATCATGATGAGTTTTGCCTTATGCCCTGAATCCTGATGGTTTCCCTAAAGTTATTACGGAAACAGACC
CCTGCTTTCGAATTTACATGTTCATGATGTGCCCTTGTTGTAAACCTTTACCTGTCACTTGTTTACGTG
GGTCTCCTATTACCAGCTTCTAATTGAATATTGTGTTTTTGAACCAGTCTGTAAGATTTTTGTTAGCAG
AAGAATTTTACCTATTGCATGGAAAGATGCTCATTATAGTGAAGTTAATAAAGCACCTTTAAAAAGCAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_018476.4
Synonyms BEX2; HBEX2; HGR74-h
Summary Signaling adapter molecule involved in p75NTR/NGFR signaling. Plays a role in cell cycle progression and neuronal differentiation. Inhibits neuronal differentiation in response to nerve growth factor (NGF). May act as a link between the cell cycle and neurotrophic factor signaling, possibly by functioning as an upstream modulator of receptor signaling, coordinating biological responses to external signals with internal cellular states (By similarity).[UniProtKB/Swiss-Prot Function]
Locus ID 55859
MW 10.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...