DDX27 (NM_017895) Human 3' UTR Clone

CAT#: SC203250

3' UTR clone of DEAD (Asp-Glu-Ala-Asp) box polypeptide 27 (DDX27) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Cited in 1 publication.

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name DDX27 (NM_017895) Human 3' UTR Clone
Vector pMirTarget
Synonyms dJ686N3.1; DRS1; Drs1p; HSPC259; PP3241; RHLP
ACCN NM_017895
Insert Size 269 bp
Sequence Data
>SC203250 3’UTR clone of NM_017895
The sequence shown below is from the reference sequence of NM_017895. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TCTAAATCCAGATACAAGAGGAGGAAGTAGCTGTCGTGGCCTGAAGAAATTCATGGGGGCAGCCCTTAA
ATCCCTTCCCTGTGGGAAGTCATCCTGGCTGGTCTGTCTTTTCTCCATTTGTTTAAAAAAAAAACAAAA
ACAAAAAACAACACTTTGGTGTGGTGGTATGGTACGTAGCTATTTTCCTAAGCATGTCTGTCAATCTCC
CTTCTTGCTGATTAGCTTTCATATGACTATATTAAATGGAAGTATTTTTGGGAAAAGAGAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_017895.8
Synonyms dJ686N3.1; DRS1; Drs1p; HSPC259; PP3241; RHLP
Summary DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein involved in the processing of 5.8S and 28S ribosomal RNAs. More specifically, the encoded protein localizes to the nucleolus, where it interacts with the PeBoW complex to ensure proper 3' end formation of 47S rRNA. [provided by RefSeq, Jan 2017]
Locus ID 55661
MW 10.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Documents

Customer Reviews 
Loading...