GPR84 (NM_020370) Human 3' UTR Clone

CAT#: SC203329

3' UTR clone of G protein-coupled receptor 84 (GPR84) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name GPR84 (NM_020370) Human 3' UTR Clone
Vector pMirTarget
Synonyms EX33; GPCR4
ACCN NM_020370
Insert Size 246 bp
Sequence Data
>SC203329 3’UTR clone of NM_020370
The sequence shown below is from the reference sequence of NM_020370. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGGCCCCGGAGTTTCCATAGGCTCCATTAGAACTGTGACCCTAGTCACCAGAATTCAGGACTGTCTCCT
CCAGGACCAAAGTGGCCAGGTAATAGGAGAATAGGTGAAATAACACATGTGGGCATTTTCACAACAATC
TCTCCCCAGCCTCCCAAATCAAGTCTCTCCATCACTTGATCAATGTTTCAGCCCTAGACTGCCCAAGGA
GTATTATTAATTATTAATAAATGAATTCTGTGCTTTTAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_020370.3
Synonyms EX33; GPCR4
Summary Receptor for medium-chain free fatty acid (FFA) with carbon chain lengths of C9 to C14. Capric acid (C10:0), undecanoic acid (C11:0) and lauric acid (C12:0) are the most potent agonists. Not activated by short-chain and long-chain saturated and unsaturated FFAs. Activation by medium-chain free fatty acid is coupled to a pertussis toxin sensitive G(i/o) protein pathway. May have important roles in processes from fatty acid metabolism to regulation of the immune system.[UniProtKB/Swiss-Prot Function]
Locus ID 53831
MW 8.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...