Cytochrome P450 2A6 (CYP2A6) (NM_000762) Human 3' UTR Clone

CAT#: SC203403

3' UTR clone of cytochrome P450 family 2 subfamily A polypeptide 6 (CYP2A6) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Cytochrome P450 2A6 (CYP2A6) (NM_000762) Human 3' UTR Clone
Vector pMirTarget
Synonyms CPA6; CYP2A; CYP2A3; CYPIIA6; P450C2A; P450PB
ACCN NM_000762
Insert Size 285 bp
Sequence Data
>SC203403 3’UTR clone of NM_000762
The sequence shown below is from the reference sequence of NM_000762. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AACTACACCATGAGCTTCCTGCCCCGCTGAGCGAGGGCTGTGCCGGTGCAGGTCTGGTGGGCGGGGCCA
GGGAAAGGGCAGGGCCAAGACCGGGCTTGGGAGAGGGGCGCAGCTAAGACTGGGGGCAGGATGGCGGAA
AGGAAGGGGCGTGGTGGCTAGAGGGAAGAGAAGAAACAGAAGCGGCTCAGTTCACCTTGATAAGGTGCT
TCCGAGCTGGGATGAGAGGAAGGAAACCCTTACATTATGCTATGAAGAGTAGTAATAATAGCAGCTCTT
ATTTCCTGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000762.6
Synonyms CPA6; CYP2A; CYP2A3; CYPIIA6; P450C2A; P450PB
Summary This gene, CYP2A6, encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and its expression is induced by phenobarbital. The enzyme is known to hydroxylate coumarin, and also metabolizes nicotine, aflatoxin B1, nitrosamines, and some pharmaceuticals. Individuals with certain allelic variants are said to have a poor metabolizer phenotype, meaning they do not efficiently metabolize coumarin or nicotine. This gene is part of a large cluster of cytochrome P450 genes from the CYP2A, CYP2B and CYP2F subfamilies on chromosome 19q. The gene was formerly referred to as CYP2A3; however, it has been renamed CYP2A6. [provided by RefSeq, Jul 2008]
Locus ID 1548
MW 10.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...