CYB5R2 (NM_016229) Human 3' UTR Clone

CAT#: SC203570

3' UTR clone of cytochrome b5 reductase 2 (CYB5R2) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Cited in 1 publication.

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name CYB5R2 (NM_016229) Human 3' UTR Clone
Vector pMirTarget
Synonyms B5R.2
ACCN NM_016229
Insert Size 300 bp
Sequence Data
>SC203570 3’UTR clone of NM_016229
The sequence shown below is from the reference sequence of NM_016229. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TATACCCAGGACATGATTTTCACCTACTAACACCTCCACGTGCTCAGCAATTTTGCATGTCCCTTTTCA
TCTGTTTCAGAGTAAGTTCAATTTCACCACGGTAAACTGGGATGTTTTCAAAAGTGCCTTGCCATGTAC
CTTCGCGCACACACTGGTTCTCCTCTTTTGGGTGTGGGCCTAACAAAAAGGGCTCAAGGGGCTGGAGAC
TGGCTGCTGGGGCCTCCTTGCTTGGAGGCTGGAAAGAGCTCCATTTCAGTATCTTTCTCCGTGGTTTTG
TGAAATAAACTCAAGTACAAAGCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_016229.5
Synonyms B5R.2
Summary The protein encoded by this gene belongs to the flavoprotein pyridine nucleotide cytochrome reductase family of proteins. Cytochrome b-type NAD(P)H oxidoreductases are implicated in many processes including cholesterol biosynthesis, fatty acid desaturation and elongation, and respiratory burst in neutrophils and macrophages. Cytochrome b5 reductases have soluble and membrane-bound forms that are the product of alternative splicing. In animal cells, the membrane-bound form binds to the endoplasmic reticulum, where it is a member of a fatty acid desaturation complex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Locus ID 51700
MW 11
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Documents

Customer Reviews 
Loading...