DAD1 (NM_001344) Human 3' UTR Clone

CAT#: SC203745

3' UTR clone of defender against cell death 1 (DAD1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name DAD1 (NM_001344) Human 3' UTR Clone
Vector pMirTarget
Synonyms OST2
ACCN NM_001344
Insert Size 305 bp
Sequence Data
>SC203745 3’UTR clone of NM_001344
The sequence shown below is from the reference sequence of NM_001344. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CACCTTGTTGTCATGAACTTTGTTGGCTGAATCATTCTCATTTACTTAATTGAGGAGTAGGAGACTAAA
AGAATGTTCACTCTTTGAATTTCCTGGATAAGAGTTCTGGAGATGGCAGCTTATTGGACACATGGATTT
TCTTCAGATTTGCACTTACTGCTAGCTCTGCTTTTTATGCAGGAGAAAAGCCCAGAGTTCACTGTGTGT
CAGAACAACTTTCTAACAAACATTTATTAATCCAGCCTCTGCCTTTCATTAAATGTAACCTTTTGCCTT
CCAAATTAAAGAACTCCATGCCACTCCTC
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001344.4
Synonyms OST2
Summary DAD1, the defender against apoptotic cell death, was initially identified as a negative regulator of programmed cell death in the temperature sensitive tsBN7 cell line. The DAD1 protein disappeared in temperature-sensitive cells following a shift to the nonpermissive temperature, suggesting that loss of the DAD1 protein triggered apoptosis. DAD1 is believed to be a tightly associated subunit of oligosaccharyltransferase both in the intact membrane and in the purified enzyme, thus reflecting the essential nature of N-linked glycosylation in eukaryotes. [provided by RefSeq, Jul 2008]
Locus ID 1603
MW 11.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...