ZSWIM8 (NM_015037) Human 3' UTR Clone

CAT#: SC203760

3' UTR clone of KIAA0913 (KIAA0913) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 5,464.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name ZSWIM8 (NM_015037) Human 3' UTR Clone
Vector pMirTarget
Synonyms KIAA0913
ACCN NM_015037
Insert Size 304 bp
Sequence Data
>SC203760 3’UTR clone of NM_015037
The sequence shown below is from the reference sequence of NM_015037. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TCACTCGAGATGGCCACCTTCTCCCCCTGAGTCTTTCACCCTTAGGGTCCTATACAGGGACCCAGGCCT
GTGGCTATGGGGGCCCCTCACACAGGGGGAGTGAAACTTGGCTGGACAGATCATCCTCACTCAGTTCCC
TGGTAGCACAGACTGACAGCTGCTCTTGGGCTATAGCTTGGGGCCAAGATGTCTCACACCCTAGAAGCC
TAGGGCTGGGGGAGACAGCCCTGTCTGGGAGGGGGCGTTGGGTGGCCTCTGGTATTTATTTGGCATTTA
TAAATATATAAACTCCTTTTTTACTCTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_015037.4
Synonyms KIAA0913
Summary Substrate recognition component of a SCF-like E3 ubiquitin-protein ligase complex that promotes target-directed microRNA degradation (TDMD), a process that mediates degradation of microRNAs (miRNAs) (PubMed:33184234, PubMed:33184237). The SCF-like E3 ubiquitin-protein ligase complex acts by catalyzing ubiquitination and subsequent degradation of AGO proteins (AGO1, AGO2, AGO3 and/or AGO4), thereby exposing miRNAs for degradation (PubMed:33184234, PubMed:33184237). Specifically recognizes and binds AGO proteins when they are engaged with a TDMD target (PubMed:33184234). May also acts as a regulator of axon guidance: specifically recognizes misfolded ROBO3 and promotes its ubiquitination and subsequent degradation (PubMed:24012004).[UniProtKB/Swiss-Prot Function]
Locus ID 23053
MW 11
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...