Glutathione S Transferase kappa 1 (GSTK1) (NM_001143681) Human 3' UTR Clone

CAT#: SC203807

3' UTR clone of glutathione S-transferase kappa 1 (GSTK1) transcript variant 4 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Glutathione S Transferase kappa 1 (GSTK1) (NM_001143681) Human 3' UTR Clone
Vector pMirTarget
Synonyms GST; GST13; GST 13-13; GST13-13; GSTK1-1; hGSTK1
ACCN NM_001143681
Insert Size 308 bp
Sequence Data
>SC203807 3’UTR clone of NM_001143681
The sequence shown below is from the reference sequence of NM_001143681. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ATACCTCCAGCCGTGAATGCCAGACTTTAAGATTGCCCGGAGGAAGCAAACTCTTCGTATAAAAAAAGC
AGGCCATCTGCTTAACCCTTGGCTCCACCATAAGGCACTGGGACTCGGATTTCTCTATCTGATAGAGGT
ATTTTCTGTGGCCCTGGGAGCTGTCTGTCTTTCCCCTACCCCCAAGGATGCCAGGAAGACGTCCACCAT
TAGCCATGTGGCAACCTTTACTTCTATGCCTCACAAGTGCCTTTCAGAGAGCCCCAATTCTGCTTTCCC
ACAAAATAAACCTAATGCCATCAGGCAAAACA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001143681.2
Synonyms GST; GST13; GST 13-13; GST13-13; GSTK1-1; hGSTK1
Summary This gene encodes a member of the kappa class of the glutathione transferase superfamily of enzymes that function in cellular detoxification. The encoded protein is localized to the peroxisome and catalyzes the conjugation of glutathione to a wide range of hydrophobic substates facilitating the removal of these compounds from cells. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Jan 2009]
Locus ID 373156
MW 11.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...