LOXL1 (NM_005576) Human 3' UTR Clone

CAT#: SC203926

3' UTR clone of lysyl oxidase-like 1 (LOXL1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name LOXL1 (NM_005576) Human 3' UTR Clone
Vector pMirTarget
Synonyms LOL; LOXL
ACCN NM_005576
Insert Size 329 bp
Sequence Data
>SC203926 3’UTR clone of NM_005576
The sequence shown below is from the reference sequence of NM_005576. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCAACAAACTGCAAAATTGTCCAATCCTGATCTCCGGGAGGGACAGATGGCCAATCTCTCCCCTTCCAA
AGCAGGCCCTGCTCCCCGGGCAGCCTCCCGCCGAGGGGCCCAGCCCCCAACCCACAGGCACGGAGGGGC
ATCCCTCCCTGCCGGCCTCAGGGAGCGAACGTGGATGAAAACCACAGGGATTCCGGACGCCAGACCCCA
TTTTATACTTCACTTTTCTCTACAGTGTTGTTTTGTTGTTGTTGGTTTTTATTTTTTATACTTTGGCCA
TACCACAGAGCTAGATTGCCCAGGTCTGGGCTGAATAAAACAAGGTTTTTCTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_005576.4
Synonyms LOL; LOXL
Summary This gene encodes a member of the lysyl oxidase family of proteins. The prototypic member of the family is essential to the biogenesis of connective tissue, encoding an extracellular copper-dependent amine oxidase that catalyzes the first step in the formation of crosslinks in collagen and elastin. The encoded preproprotein is proteolytically processed to generate the mature enzyme. A highly conserved amino acid sequence at the C-terminus end appears to be sufficient for amine oxidase activity, suggesting that each family member may retain this function. The N-terminus is poorly conserved and may impart additional roles in developmental regulation, senescence, tumor suppression, cell growth control, and chemotaxis to each member of the family. Mutations in this gene are associated with exfoliation syndrome. [provided by RefSeq, Jan 2016]
Locus ID 4016
MW 12.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...