cPLA2 beta (PLA2G4B) (NM_001114633) Human 3' UTR Clone

CAT#: SC203996

3' UTR clone of phospholipase A2 group IVB (cytosolic) (PLA2G4B) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Cited in 1 publication.

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name cPLA2 beta (PLA2G4B) (NM_001114633) Human 3' UTR Clone
Vector pMirTarget
Synonyms cPLA2-beta; HsT16992
ACCN NM_001114633
Insert Size 313 bp
Sequence Data
>SC203996 3’UTR clone of NM_001114633
The sequence shown below is from the reference sequence of NM_001114633. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CAGCGGAGGCGGCAGCGCAGGCCCCACTGATGGCCGGGGCCCCTGCCACCCCTAACTCTCATTCATTCC
CTGGCTGCTGAGTTGCAGGTGGGAACTGTCATCACGCAGTGCTTCAGAGCCTCGGGCTCAGGTGGCACG
GTCCCAGGGTCCAGGCTGAGGGCTGGGAGCTCCCTTGCGCCTCAGCAGTTTGCAGTGGGGTAAGGAGGC
CAAGCCCATTTGTGTAATCACCCAAAACCCCCCGGCCTGTGCCTGTTTTCCCTTCTGCGCTACCTTGAG
TAGTTGGAGCACTTGATACATCACAGACTCATACAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001114633.2
Synonyms cPLA2-beta; HsT16992
Summary This gene encodes a member of the cytosolic phospholipase A2 protein family. Phospholipase A2 enzymes hydrolyze the sn-2 bond of phospholipids, releasing lysophospholipids and fatty acids. This enzyme may be associated with mitochondria and early endosomes. Most tissues also express read-through transcripts from the upstream gene into this gene, some of which may encode fusion proteins combining the N-terminus of the upstream gene including its JmjC domain with the almost complete coding region of this gene, including the C2 and cytoplasmic phospholipase A2 domains. [provided by RefSeq, Jul 2008]
Locus ID 100137049
MW 11.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Documents

Customer Reviews 
Loading...