PIGC (NM_153747) Human 3' UTR Clone

CAT#: SC204043

3' UTR clone of phosphatidylinositol glycan anchor biosynthesis class C (PIGC) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name PIGC (NM_153747) Human 3' UTR Clone
Vector pMirTarget
Synonyms GPI2; GPIBD16; MRT62
ACCN NM_153747
Insert Size 302 bp
Sequence Data
>SC204043 3’UTR clone of NM_153747
The sequence shown below is from the reference sequence of NM_153747. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AAGGAAGACTTGTCCAGGTTCCTCAGTTAAATTAGGACATCCATTACATTATTAAAGCAAGCTGATAGA
TTAGCCTCCTAACTAGTATAGAACTTAAAGACAGAGTTCCATTCTGGAAGCAGCATGTCATTGTGGTAA
GAGAATAGAGATCAAAACCAAAAAAAATGAACCAAAGGCTTGGGTGGTGAGGGTGCTTATCCTTTCTGT
TATTTTGTAGATGAAAAAACTTTCTGGGGACCTCTTGAATTACATGCTGTAACATATGAAGTGATGTGG
TTTCTATTAAAAAAATAACACATCCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_153747.2
Synonyms GPI2; GPIBD16; MRT62
Summary This gene encodes an endoplasmic reticulum associated protein that is involved in glycosylphosphatidylinositol (GPI) lipid anchor biosynthesis. The GPI lipid anchor is a glycolipid found on many blood cells and serves to anchor proteins to the cell surface. The encoded protein is one subunit of the GPI N-acetylglucosaminyl (GlcNAc) transferase that transfers GlcNAc to phosphatidylinositol (PI) on the cytoplasmic side of the endoplasmic reticulum. Two alternatively spliced transcripts that encode the same protein have been found for this gene. A pseudogene on chromosome 11 has also been characterized. [provided by RefSeq, Jul 2008]
Locus ID 5279
MW 11.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...