HSPA6 (NM_002155) Human 3' UTR Clone

CAT#: SC204216

3' UTR clone of heat shock 70kDa protein 6 (HSP70B') (HSPA6) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name HSPA6 (NM_002155) Human 3' UTR Clone
Vector pMirTarget
Synonyms HSP70B'
ACCN NM_002155
Insert Size 334 bp
Sequence Data
>SC204216 3’UTR clone of NM_002155
The sequence shown below is from the reference sequence of NM_002155. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ACCGGCCCCATCATTGAGGAGGTTGATTGAATGGCCCTTCGTGATAAGTCAGCTGTGACTGTCAGGGCT
ATGCTATGGGCCTTCTAGACTGTCTTCTATGATCCTGCCCTTCAGAGATGAACTTTCCCTCCAAAGCTA
GAACTTTCTTCCCAGGATAACTGAAGTCTTTTGACTTTTTGCGGGGAGGGCGGTTCATCCTCTTCTGCT
TCAAATAAAAAGTCATTAATTTATTAAAACTTGTGTGGCACTTTAACATTGCTTTCACCTATATTTTGT
GTACTTTGTTACTTGCATGTATGAATTTTGTTATGTAAAATATAGTTATAGACCTAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002155.5
Synonyms HSP70B'
Summary Molecular chaperone implicated in a wide variety of cellular processes, including protection of the proteome from stress, folding and transport of newly synthesized polypeptides, activation of proteolysis of misfolded proteins and the formation and dissociation of protein complexes. Plays a pivotal role in the protein quality control system, ensuring the correct folding of proteins, the re-folding of misfolded proteins and controlling the targeting of proteins for subsequent degradation. This is achieved through cycles of ATP binding, ATP hydrolysis and ADP release, mediated by co-chaperones. The affinity for polypeptides is regulated by its nucleotide bound state. In the ATP-bound form, it has a low affinity for substrate proteins. However, upon hydrolysis of the ATP to ADP, it undergoes a conformational change that increases its affinity for substrate proteins. It goes through repeated cycles of ATP hydrolysis and nucleotide exchange, which permits cycles of substrate binding and release (PubMed:26865365).[UniProtKB/Swiss-Prot Function]
Locus ID 3310
MW 12.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...