TYK2 (NM_003331) Human 3' UTR Clone

CAT#: SC204234

3' UTR clone of tyrosine kinase 2 (TYK2) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name TYK2 (NM_003331) Human 3' UTR Clone
Vector pMirTarget
Synonyms IMD35; JTK1
ACCN NM_003331
Insert Size 331 bp
Sequence Data
>SC204234 3’UTR clone of NM_003331
The sequence shown below is from the reference sequence of NM_003331. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CAGGCCCCTTCAGTGTTCAGCGTGTGCTGAGGCACAATGGCAGCCCTGCCTGGGAGGACTGGACCAGGC
AGTGGCTGCAGAGGGAGCCTCCTGCTCCCTGCTCCAGGATGAAACCAAGAGGGGGATGTCAGCCTCACC
CACACCGTGTGCCTTACTCCTGTCTAGAGACCCCACCTCTGTGAACTTATTTTTCTTTCTTGGCCGTGA
GCCTAACCATGATCTTGAGGGACCCAACATTTGTAGGGGCACTAATCCAGCCCTTAAATCCCCCAGCTT
CCAAACTTGAGGCCCACCATCTCCACCATCTGGTAATAAACTCATGTTTTCTCTG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_003331.5
Synonyms IMD35; JTK1
Summary This gene encodes a member of the tyrosine kinase and, more specifically, the Janus kinases (JAKs) protein families. This protein associates with the cytoplasmic domain of type I and type II cytokine receptors and promulgate cytokine signals by phosphorylating receptor subunits. It is also a component of both the type I and type III interferon signaling pathways. As such, it may play a role in anti-viral immunity. A mutation in this gene has been associated with Immunodeficiency 35. [provided by RefSeq, Sep 2020]
Locus ID 7297
MW 11.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...