Small EDRK rich factor 1 (SERF1A) (NM_022968) Human 3' UTR Clone

CAT#: SC204308

3' UTR clone of small EDRK-rich factor 1A (telomeric) (SERF1A) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Cited in 1 publication.

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Small EDRK rich factor 1 (SERF1A) (NM_022968) Human 3' UTR Clone
Vector pMirTarget
Synonyms 4F5; FAM2A; H4F5; SERF1; SMAM1
ACCN NM_022968
Insert Size 339 bp
Sequence Data
>SC204308 3’UTR clone of NM_022968
The sequence shown below is from the reference sequence of NM_022968. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AAGAAGTCTATGCAGACAAGAGAAAAGTGATGACTGGCTATTTGGAAAACCTGGGTGCTACTGCCAACT
GGGTGTATCATAAGCTCTAAGATCAAGATTTTGTAGAGTGGACAGTCATTACATATGTTATAACTTATC
CTTTAAAAACTATTTTAAACTTTATCCTTTCAGCTTTACTTAGTGCGATGTTTTAGAAGCAGTCTTCAA
AGAATAAAACACTAACCATGCATGTGACATATTGGTGAACATTATTTTTATTATTGAACATTCATATAT
AATTTATTAGGTAATATGATCAGATAATAGGATCTCTTATATAATAAAGAATCTTTGTCATCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_022968.2
Synonyms 4F5; FAM2A; H4F5; SERF1; SMAM1
Summary This gene is part of a 500 kb inverted duplication on chromosome 5q13. This duplicated region contains at least four genes and repetitive elements which make it prone to rearrangements and deletions. The repetitiveness and complexity of the sequence have also caused difficulty in determining the organization of this genomic region. The duplication region includes both a telomeric and a centromeric copy of this gene. Deletions of this gene, the telomeric copy, often accompany deletions of the neighboring SMN1 gene in spinal muscular atrophy (SMA) patients, and so it is thought that this gene may be a modifier of the SMA phenotype. The function of this protein is not known; however, it bears low-level homology with the RNA-binding domain of matrin-cyclophilin, a protein which colocalizes with small nuclear ribonucleoproteins (snRNPs) and the SMN1 gene product. Alternatively spliced transcripts have been documented but it is unclear whether alternative splicing occurs for both the centromeric and telomeric copies of the gene. [provided by RefSeq, Jul 2008]
Locus ID 8293
MW 13.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Documents

Customer Reviews 
Loading...