CCL4L1 (NM_207007) Human 3' UTR Clone

CAT#: SC204382

3' UTR clone of chemokine (C-C motif) ligand 4-like 2 (CCL4L2) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name CCL4L1 (NM_207007) Human 3' UTR Clone
Vector pMirTarget
Synonyms AT744.2; CCL4L; LAG-1; LAG1; MIP-1-beta; SCYA4L; SCYA4L1; SCYA4L2
ACCN NM_207007
Insert Size 357 bp
Sequence Data
>SC204382 3’UTR clone of NM_207007
The sequence shown below is from the reference sequence of NM_207007. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAGTACGTGTATGACCTGGAACTGAACTGAGCTGCTCAGAGACAGGAAGTCTTCAGGGAAGGTCACCTG
AGCCTGGATGCTTCTCCATGAGCCGCATCTCCTCCATACTCAGGACTCCTCTCCGCAGTTCCTGTCTCT
TCTCTTAATGTAATCTCTTTTATGTGCTGTATTATTGTATTAGGTGTTATTTCCATTATTTATATTAGT
TTAGCCAAAGGATAAGTGTCCCCTATGGGGATGGTCCACTCTCACTCTTTCTCTGCTGTTGCAAATACA
TGGATAACACCGTTAATTCCATGTGTTTTCATAATAAAACTTTAAAATAAAATGCAAACAGTTAAAAAA
AAAAAAAAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_207007.3
Synonyms AT744.2; CCL4L; LAG-1; LAG1; MIP-1-beta; SCYA4L; SCYA4L1; SCYA4L2
Summary This gene is one of several cytokine genes that are clustered on the q-arm of chromosome 17. Cytokines are a family of secreted proteins that function in inflammatory and immunoregulatory processes. The protein encoded by this family member is similar to the chemokine (C-C motif) ligand 4 product, which inhibits HIV entry by binding to the cellular receptor CCR5. The copy number of this gene varies among individuals, where most individuals have one to five copies. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2014]
Locus ID 388372
MW 13
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...