ADAM15 (NM_207191) Human 3' UTR Clone

CAT#: SC204426

3' UTR clone of ADAM metallopeptidase domain 15 (ADAM15) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name ADAM15 (NM_207191) Human 3' UTR Clone
Vector pMirTarget
Synonyms MDC15
ACCN NM_207191
Insert Size 359 bp
Sequence Data
>SC204426 3’UTR clone of NM_207191
The sequence shown below is from the reference sequence of NM_207191. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CCGGCCCAGGGGCTGGAATCCCGCCCCTAGTGGTACCCTCCAGACCAGCGCCACCGCCTCCGACAGTGT
CCTCGCTCTACCTCTGACCTCTCCGGAGGTTCCGCTGCCTCCAAGCCGGACTTAGGGCTTCAAGAGGCG
GGCGTGCCCTCTGGAGTCCCCTACCATGACTGAAGGCGCCAGAGACTGGCGGTGTCTTAAGACTCCGGG
CACCGCCACGCGCTGTCAAGCAACACTCTGCGGACCTGCCGGCGTAGTTGCAGCGGGGGCTTGGGGAGG
GGCTGGGGGTTGGACGGGATTGAGGAAGGTCCGCACAGCCTGTCTCTGCTCAGTTGCAATAAACGTGAC
ATCTTGGGAGCGTT
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_207191.3
Synonyms MDC15
Summary The protein encoded by this gene is a member of the ADAM (a disintegrin and metalloproteinase) protein family. ADAM family members are type I transmembrane glycoproteins known to be involved in cell adhesion and proteolytic ectodomain processing of cytokines and adhesion molecules. This protein contains multiple functional domains including a zinc-binding metalloprotease domain, a disintegrin-like domain, as well as a EGF-like domain. Through its disintegrin-like domain, this protein specifically interacts with the integrin beta chain, beta 3. It also interacts with Src family protein-tyrosine kinases in a phosphorylation-dependent manner, suggesting that this protein may function in cell-cell adhesion as well as in cellular signaling. Multiple alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
Locus ID 8751
MW 12.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...