UCP2 (NM_003355) Human 3' UTR Clone

CAT#: SC204466

3' UTR clone of uncoupling protein 2 (mitochondrial proton carrier) (UCP2) nuclear gene encoding mitochondrial protein for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Cited in 1 publication.

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name UCP2 (NM_003355) Human 3' UTR Clone
Vector pMirTarget
Synonyms BMIQ4; SLC25A8; UCPH
ACCN NM_003355
Insert Size 365 bp
Sequence Data
>SC204466 3’UTR clone of NM_003355
The sequence shown below is from the reference sequence of NM_003355. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCCTGCACTTCCCGAGAGGCTCCCTTCTGAGCCTCTCCTGCTGCTGACCTGATCACCTCTGGCTTTGTC
TCTAGCCGGGCCATGCTTTCCTTTTCTTCCTTCTTTCTCTTCCCTCCTTCCCTTCTCTCCTTCCCTCTT
TCCCCACCTCTTCCTTCCGCTCCTTTACCTACCACCTTCCCTCTTTCTACATTCTCATCTACTCATTGT
CTCAGTGCTGGTGGAGTTGACATTTGACAGTGTGGGAGGCCTCGTACCAGCCAGGATCCCAAGCGTCCC
GTCCCTTGGAAAGTTCAGCCAGAATCTTCGTCCTGCCCCCGACAGCCCAGCCTAGCCCACTTGTCATCC
ATAAAGCAAGCTCAACCTTG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_003355.3
Synonyms BMIQ4; SLC25A8; UCPH
Summary Mitochondrial uncoupling proteins (UCP) are members of the larger family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. Tissue specificity occurs for the different UCPs and the exact methods of how UCPs transfer H+/OH- are not known. UCPs contain the three homologous protein domains of MACPs. This gene is expressed in many tissues, with the greatest expression in skeletal muscle. It is thought to play a role in nonshivering thermogenesis, obesity and diabetes. Chromosomal order is 5'-UCP3-UCP2-3'. [provided by RefSeq, Jul 2008]
Locus ID 7351
MW 12.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Documents

Customer Reviews 
Loading...