LGALS3BP (NM_005567) Human 3' UTR Clone

CAT#: SC204546

3' UTR clone of lectin galactoside-binding soluble 3 binding protein (LGALS3BP) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Cited in 1 publication.

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name LGALS3BP (NM_005567) Human 3' UTR Clone
Vector pMirTarget
Synonyms 90K; BTBD17B; CyCAP; gp90; M2BP; MAC-2-BP; TANGO10B
ACCN NM_005567
Insert Size 351 bp
Sequence Data
>SC204546 3’UTR clone of NM_005567
The sequence shown below is from the reference sequence of NM_005567. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TACCTGACCAACTCCTCAGGTGTGGACTAGACGGCGTGGCCCAAGGGTGGTGAGAACCGGAGAACCCCA
GGACGCCCTCACTGCAGGCTCCCCTCCTCGGCTTCCTTCCTCTCTGCAATGACCTTCAACAACCGGCCA
CCAGATGTCGCCCTACTCACCTGAGCGCTCAGCTTCAAGAAATTACTGGAAGGCTTCCACTAGGGTCCA
CCAGGAGTTCTCCCACCACCTCACCAGTTTCCAGGTGGTAAGCACCAGGACGCCCTCGAGGTTGCTCTG
GGATCCCCCCACAGCCCCTGGTCAGTCTGCCCTTGTCACTGGTCTGAGGTCATTAAAATTACATTGAGG
TTCCTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_005567.4
Synonyms 90K; BTBD17B; CyCAP; gp90; M2BP; MAC-2-BP; TANGO10B
Summary The galectins are a family of beta-galactoside-binding proteins implicated in modulating cell-cell and cell-matrix interactions. LGALS3BP has been found elevated in the serum of patients with cancer and in those infected by the human immunodeficiency virus (HIV). It appears to be implicated in immune response associated with natural killer (NK) and lymphokine-activated killer (LAK) cell cytotoxicity. Using fluorescence in situ hybridization the full length 90K cDNA has been localized to chromosome 17q25. The native protein binds specifically to a human macrophage-associated lectin known as Mac-2 and also binds galectin 1. [provided by RefSeq, Jul 2008]
Locus ID 3959
MW 12.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Documents

Customer Reviews 
Loading...