ADA (NM_000022) Human 3' UTR Clone

CAT#: SC204629

3' UTR clone of adenosine deaminase (ADA) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name ADA (NM_000022) Human 3' UTR Clone
Vector pMirTarget
Synonyms ADA1
ACCN NM_000022
Insert Size 342 bp
Sequence Data
>SC204629 3’UTR clone of NM_000022
The sequence shown below is from the reference sequence of NM_000022. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CCTTCAGCCTCTGCAGGGCAGAACCTCTGAAGACGCCACTCCTCCAAGCCTTCACCCTGTGGAGTCACC
CCAACTCTGTGGGGCTGAGCAACATTTTTACATTTATTCCTTCCAAGAAGACCATGATCTCAATAGTCA
GTTACTGATGCTCCTGAACCCTATGTGTCCATTTCTGCACACACGTATACCTCGGCATGGCCGCGTCAC
TTCTCTGATTATGTGCCCTGGCCAGGGACCAGCGCCCTTGCACATGGGCATGGTTGAATCTGAAACCCT
CCTTCTGTGGCAACTTGTACTGAAAATCTGGTGCTCAATAAAGAAGCCCATGGCTGGTGGCATGCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000022.4
Synonyms ADA1
Summary This gene encodes an enzyme that catalyzes the hydrolysis of adenosine to inosine in the purine catabolic pathway. Various mutations have been described for this gene and have been linked to human diseases related to impaired immune function such as severe combined immunodeficiency disease (SCID) which is the result of a deficiency in the ADA enzyme. In ADA-deficient individuals there is a marked depletion of T, B, and NK lymphocytes, and consequently, a lack of both humoral and cellular immunity. Conversely, elevated levels of this enzyme are associated with congenital hemolytic anemia. [provided by RefSeq, Sep 2019]
Locus ID 100
MW 12.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...