hnRNP L (HNRNPL) (NM_001533) Human 3' UTR Clone

CAT#: SC204675

3' UTR clone of heterogeneous nuclear ribonucleoprotein L (HNRNPL) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name hnRNP L (HNRNPL) (NM_001533) Human 3' UTR Clone
Vector pMirTarget
Synonyms hnRNP-L; HNRPL; P/OKcl.14
ACCN NM_001533
Insert Size 382 bp
Sequence Data
>SC204675 3’UTR clone of NM_001533
The sequence shown below is from the reference sequence of NM_001533. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TGTTTCTCCACTGCTCAGCACGCCTCCTAATTAGGTGCCTAGGAAGAGTCCCATCTGAGCAGGAAGACA
TTTCTCTTTCCTTTATGCCATTTTTTGTTTTTGTTATTTGCAAAAGATCTTGTATTCCTTTTTTTTTTT
TTTTTTTTTTTTTTTAAATGCTAGGTTTGTAGAGGCTTACTTAACCTTAATGGAAACGCTGGAAATCTG
CAGGGGGAGGGAGAGGGGAACTGTTATCTCCCAAGATTAACCTTCACTTTTAAAAAATTATTGTACATG
TGATTTTTTTTTTTCCTGTTCATACATTTGTGCTGCCCATGTACTCTTGGCACATTTCAATAAAATTGT
TTGGAAAATAAACACAGCACTTGCTGGGATTCCAGGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001533.3
Synonyms hnRNP-L; HNRPL; P/OKcl.14
Summary Heterogeneous nuclear RNAs (hnRNAs) which include mRNA precursors and mature mRNAs are associated with specific proteins to form heterogenous ribonucleoprotein (hnRNP) complexes. Heterogeneous nuclear ribonucleoprotein L is among the proteins that are stably associated with hnRNP complexes and along with other hnRNP proteins is likely to play a major role in the formation, packaging, processing, and function of mRNA. Heterogeneous nuclear ribonucleoprotein L is present in the nucleoplasm as part of the HNRP complex. HNRP proteins have also been identified outside of the nucleoplasm. Exchange of hnRNP for mRNA-binding proteins accompanies transport of mRNA from the nucleus to the cytoplasm. Since HNRP proteins have been shown to shuttle between the nucleus and the cytoplasm, it is possible that they also have cytoplasmic functions. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Locus ID 3191
MW 14.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...