Hydroxysteroid (17 beta) Dehydrogenase 4 (HSD17B4) (NM_000414) Human 3' UTR Clone

CAT#: SC204821

3' UTR clone of hydroxysteroid (17-beta) dehydrogenase 4 (HSD17B4) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Hydroxysteroid (17 beta) Dehydrogenase 4 (HSD17B4) (NM_000414) Human 3' UTR Clone
Vector pMirTarget
Synonyms DBP; MFE-2; MFP-2; MPF-2; PRLTS1; SDR8C1
ACCN NM_000414
Insert Size 368 bp
Sequence Data
>SC204821 3’UTR clone of NM_000414
The sequence shown below is from the reference sequence of NM_000414. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ATGATTCTTAAAGACTACGCCAAGCTCTGAAGGGCACACTACACTATTAATAAAAATGGAATCATTAAA
TACTCTCTTCACCCAAATATGCTTGATTATTCTGCAAAAGTGATTAGAACTAAGATGCAGGGGAAATTG
CTTAACATTTTCAGATATCAGATAACTGCAGATTTTCATTTTCTACTAATTTTTCATGTATCATTATTT
TTACAAGGAACTATATATAAGCTAGCACATAATTATCCTTCTGTTCTTAGATCTGTATCTTCATAATAA
AAAATTTTGCCCAAGTCCTGTTTCCTTAGAATTTGTGATAGCATTGATAAGTTGAAAGGAAAATTAAAT
CAATAAAGGCCTTTGATACCTTT
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000414.4
Synonyms DBP; MFE-2; MFP-2; MPF-2; PRLTS1; SDR8C1
Summary The protein encoded by this gene is a bifunctional enzyme that is involved in the peroxisomal beta-oxidation pathway for fatty acids. It also acts as a catalyst for the formation of 3-ketoacyl-CoA intermediates from both straight-chain and 2-methyl-branched-chain fatty acids. Defects in this gene that affect the peroxisomal fatty acid beta-oxidation activity are a cause of D-bifunctional protein deficiency (DBPD). An apparent pseudogene of this gene is present on chromosome 8. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2014]
Locus ID 3295
MW 14.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...