HLA-DRB5 (NM_002125) Human 3' UTR Clone

CAT#: SC204920

3' UTR clone of major histocompatibility complex class II DR beta 5 (HLA-DRB5) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name HLA-DRB5 (NM_002125) Human 3' UTR Clone
Vector pMirTarget
Synonyms HLA-DRB5*
ACCN NM_002125
Insert Size 416 bp
Sequence Data
>SC204920 3’UTR clone of NM_002125
The sequence shown below is from the reference sequence of NM_002125. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGACTTCACCCAACAGGACTCGTGAGCTGAAGTGCAGATGACCACATTCAAGGGGGAACCTTCTGCCCC
AGCTTTGCATGATGAAAAGCTTTCCTGCTTGGCTCTTATTCTTCCACAAGAGAGGACTTTCTCAGGCCC
TGGTTGCTACCGGTTCAGCAACTCTGCAGAAAATGTCCATCCTTGTGGCTTCCTCAGCTCCTGCCCTTG
GCCTGAAGTCCCAGCATTGATGGCAGTGCCTCATCTTCAACTTTAGTGCTCCCCTTTACCTAACCCTAC
GGCCTCCCATGCATCTGTACTCCCCCTGTGTGCCACAAATGCACTACGTTATTAAATTTTTCTGAAGCC
CAGAGTTAAAAATCATCTGTCCACCTGGCTCCAAAGACAAAAAATAAAAAGAAAAGAAAAAGGGAAGAT
TA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002125.4
Synonyms HLA-DRB5*
Summary HLA-DRB5 belongs to the HLA class II beta chain paralogues. This class II molecule is a heterodimer consisting of an alpha (DRA) and a beta (DRB) chain, both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells. The beta chain is approximately 26-28 kDa and its gene contains 6 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and exon 5 encodes the cytoplasmic tail. Within the DR molecule the beta chain contains all the polymorphisms specifying the peptide binding specificities. Typing for these polymorphisms is routinely done for bone marrow and kidney transplantation. There are multiple pseudogenes of this gene. [provided by RefSeq, Feb 2020]
Locus ID 3127
MW 15.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...