MMP12 (NM_002426) Human 3' UTR Clone

CAT#: SC204936

3' UTR clone of matrix metallopeptidase 12 (macrophage elastase) (MMP12) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name MMP12 (NM_002426) Human 3' UTR Clone
Vector pMirTarget
Synonyms HME; ME; MME; MMP-12
ACCN NM_002426
Insert Size 394 bp
Sequence Data
>SC204936 3’UTR clone of NM_002426
The sequence shown below is from the reference sequence of NM_002426. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTGAAAAGCAATAGCTGGTTTGGTTGTTAGAAATGGTGTAATTAATGGTTTTTGTTAGTTCACTTCAGC
TTAATAAGTATTTATTGCATATTTGCTATGTCCTCAGTGTACCACTACTTAGAGATATGTATCATAAAA
ATAAAATCTGTAAACCATAGGTAATGATTATATAAAATACATAATATTTTTCAATTTTGAAAACTCTAA
TTGTCCATTCTTGCTTGACTCTACTATTAAGTTTGAAAATAGTTACCTTCAAAGGCCAAGAGAATTCTA
TTTGAAGCATGCTCTGTAAGTTGCTTCCTAACATCCTTGGACTGAGAAATTATACTTACTTCTGGCATA
ACTAAAATTAAGTATATATATTTTGGCTCAAATAAAATTGAAAAAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002426.6
Synonyms HME; ME; MME; MMP-12
Summary This gene encodes a member of the peptidase M10 family of matrix metalloproteinases (MMPs). Proteins in this family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease degrades soluble and insoluble elastin. This gene may play a role in aneurysm formation and mutations in this gene are associated with lung function and chronic obstructive pulmonary disease (COPD). This gene is part of a cluster of MMP genes on chromosome 11. [provided by RefSeq, Jan 2016]
Locus ID 4321
MW 15.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...