DHX58 (NM_024119) Human 3' UTR Clone

CAT#: SC204998

3' UTR clone of DEXH (Asp-Glu-X-His) box polypeptide 58 (DHX58) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name DHX58 (NM_024119) Human 3' UTR Clone
Vector pMirTarget
Synonyms D11LGP2; D11lgp2e; LGP2; RLR-3
ACCN NM_024119
Insert Size 380 bp
Sequence Data
>SC204998 3’UTR clone of NM_024119
The sequence shown below is from the reference sequence of NM_024119. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAGAACTTGTCGGACCTCTCCCTGGACTGACCACCTCATTGCTGCAGTGCCCGGTTTGGGCTGTAGGGG
GCGGGAGAGTCTGCAGCAGACTCCAGGCCCCTCCTTCCTGAATCATCAGCTGTGGGCATCAGGCCCACC
AGCCACACAGGAGTCCTGGGCACCCTGGCTTAGGCTCCCGCAATGGGAAAACAACCGGAGGGCCAGAGC
TTAGTCCAGACCTACCTTGTACGCACATAGACATTTTCATATGCACTGGATGGAGTTAGGGAAACTGAG
GCAAAAGAATTTGCCATACTGTACTCAGAATCACGACATTCCTTCCCTACCAAGGCCACTTCTATTTTT
TGAGGCTCCTCATAAAAATAAATGAAAAAATGGGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_024119.3
Synonyms D11LGP2; D11lgp2e; LGP2; RLR-3
Summary Acts as a regulator of DDX58/RIG-I and IFIH1/MDA5 mediated antiviral signaling. Cannot initiate antiviral signaling as it lacks the CARD domain required for activating MAVS/IPS1-dependent signaling events. Can have both negative and positive regulatory functions related to DDX58/RIG-I and IFIH1/MDA5 signaling and this role in regulating signaling may be complex and could probably depend on characteristics of the infecting virus or target cells, or both. Its inhibitory action on DDX58/RIG-I signaling may involve the following mechanisms: competition with DDX58/RIG-I for binding to the viral RNA, binding to DDX58/RIG-I and inhibiting its dimerization and interaction with MAVS/IPS1, competing with IKBKE in its binding to MAVS/IPS1 thereby inhibiting activation of interferon regulatory factor 3 (IRF3). Its positive regulatory role may involve unwinding or stripping nucleoproteins of viral RNA thereby facilitating their recognition by DDX58/RIG-I and IFIH1/MDA5. Involved in the innate immune response to various RNA viruses and some DNA viruses such as poxviruses, and also to the bacterial pathogen Listeria monocytogenes. Can bind both ssRNA and dsRNA, with a higher affinity for dsRNA. Shows a preference to 5'-triphosphorylated RNA, although it can recognize RNA lacking a 5'-triphosphate.[UniProtKB/Swiss-Prot Function]
Locus ID 79132
MW 13.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...