Microsomal Glutathione S transferase 1 (MGST1) (NM_145792) Human 3' UTR Clone

CAT#: SC205061

3' UTR clone of microsomal glutathione S-transferase 1 (MGST1) transcript variant 1a for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Microsomal Glutathione S transferase 1 (MGST1) (NM_145792) Human 3' UTR Clone
Vector pMirTarget
Synonyms GST12; MGST; MGST-I
ACCN NM_145792
Insert Size 399 bp
Sequence Data
>SC205061 3’UTR clone of NM_145792
The sequence shown below is from the reference sequence of NM_145792. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AGGTTGCTGAAAAGTAAATTGTACCTGTAAAGAAAATCATACAACTCAGCATCCAGTTGGCTTTTTAAG
AATTCTGTACTTCCAATTTATAATGAATACTTTCTTAGATTTTAGGTAGGAGGGGAGCAGAGGAATTAT
GAACTGGGGTAAACCCATTTTGAATATTAGCATTGCCAATATCCTGTATTCTTGTTTTACATTTGGATT
AGAAATTTAACATAGTAATTCTTAAGTCTTTTGTCTGATTTTTAAAGTACTTTCTTATAAATTTGGATC
ATGTTATGATTTGTAACATTCACACAACACCTCACTTTTGAATCTATAAAAGAATTGCACGTATGAGAA
ACCTATATTTCAATACTGCTGAAACAGACATGAAATAAAGAATTTAAAGAATGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_145792.3
Synonyms GST12; MGST; MGST-I
Summary The MAPEG (Membrane Associated Proteins in Eicosanoid and Glutathione metabolism) family consists of six human proteins, two of which are involved in the production of leukotrienes and prostaglandin E, important mediators of inflammation. Other family members, demonstrating glutathione S-transferase and peroxidase activities, are involved in cellular defense against toxic, carcinogenic, and pharmacologically active electrophilic compounds. This gene encodes a protein that catalyzes the conjugation of glutathione to electrophiles and the reduction of lipid hydroperoxides. This protein is localized to the endoplasmic reticulum and outer mitochondrial membrane where it is thought to protect these membranes from oxidative stress. Several transcript variants, some non-protein coding and some protein coding, have been found for this gene. [provided by RefSeq, May 2012]
Locus ID 4257
MW 16.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...