ATG4D (NM_032885) Human 3' UTR Clone

CAT#: SC205161

3' UTR clone of ATG4 autophagy related 4 homolog D (S. cerevisiae) (ATG4D) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name ATG4D (NM_032885) Human 3' UTR Clone
Vector pMirTarget
Synonyms APG4-D; APG4D; AUTL4
ACCN NM_032885
Insert Size 381 bp
Sequence Data
>SC205161 3’UTR clone of NM_032885
The sequence shown below is from the reference sequence of NM_032885. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CCCAGCTCTGAGGACTTTGTGTTTTTATAAAGGGAGGGGATGAGGGGAAAGATACAACACTATTTATTT
TTTTATTTATGTCATGTCGGGTGTGGGATCTTGAGCTCTGGCAGTGATGATGGTACTTCCTGTTGTCAG
CCCCTCAAGCCCAGCTGCAACCAGTCTGGGGCCATTCAGCCAGGGACAGAGCCCACAGAGCCCATACAC
CTGTCTCCCACCAGCGGGGCCCTCCTGGCAGGGTAGGGAAGGAGGACCCCGGGCACCCCCCTCAGGGCC
TGACTCACGTACTGTAGTTTGCACTGGACGCCCGGGCCCTCCCTGTCCCAAAGCCCCCTTGGGGGAACT
GTGGCTGCTGGGGGCCAATAAAGCTGTGTAACTTGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_032885.6
Synonyms APG4-D; APG4D; AUTL4
Summary Autophagy is the process by which endogenous proteins and damaged organelles are destroyed intracellularly. Autophagy is postulated to be essential for cell homeostasis and cell remodeling during differentiation, metamorphosis, non-apoptotic cell death, and aging. Reduced levels of autophagy have been described in some malignant tumors, and a role for autophagy in controlling the unregulated cell growth linked to cancer has been proposed. This gene belongs to the autophagy-related protein 4 (Atg4) family of C54 endopeptidases. Members of this family encode proteins that play a role in the biogenesis of autophagosomes, which sequester the cytosol and organelles for degradation by lysosomes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Locus ID 84971
MW 13.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...