Glypican 3 (GPC3) (NM_001164619) Human 3' UTR Clone

CAT#: SC205248

3' UTR clone of glypican 3 (GPC3) transcript variant 4 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Glypican 3 (GPC3) (NM_001164619) Human 3' UTR Clone
Vector pMirTarget
Synonyms DGSX; GTR2-2; MXR7; OCI-5; SDYS; SGB; SGBS; SGBS1
ACCN NM_001164619
Insert Size 409 bp
Sequence Data
>SC205248 3’UTR clone of NM_001164619
The sequence shown below is from the reference sequence of NM_001164619. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GTGGTGTGCTTCTTCTTCCTGGTGCACTGACTGCCTGGTGCCCAGCACATGTGCTGCCCTACAGCACCC
TGTGGTCTTCCTCGATAAAGGGAACCACTTTCTTATTTTTTTCTATTTTTTTTTTTTTGTTATCCTGTA
TACCTCCTCCAGCCATGAAGTAGAGGACTAACCATGTGTTATGTTTTCGAAAATCAAATGGTATCTTTT
GGAGGAAGATACATTTTAGTGGTAGCATATAGATTGTCCTTTTGCAAAGAAAGAAAAAAAACCATCAAG
TTGTGCCAAATTATTCTCCTATGTTTGGCTGCTAGAACATGGTTACCATGTCTTTCTCTCTCACTCCCT
CCCTTTCTATCGTTCTCTCTTTGCATGGATTTCTTTGAAAAAAAATAAATTGCTCAAATAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001164619.2
Synonyms DGSX; GTR2-2; MXR7; OCI-5; SDYS; SGB; SGBS; SGBS1
Summary Cell surface heparan sulfate proteoglycans are composed of a membrane-associated protein core substituted with a variable number of heparan sulfate chains. Members of the glypican-related integral membrane proteoglycan family (GRIPS) contain a core protein anchored to the cytoplasmic membrane via a glycosyl phosphatidylinositol linkage. These proteins may play a role in the control of cell division and growth regulation. The protein encoded by this gene can bind to and inhibit the dipeptidyl peptidase activity of CD26, and it can induce apoptosis in certain cell types. Deletion mutations in this gene are associated with Simpson-Golabi-Behmel syndrome, also known as Simpson dysmorphia syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
Locus ID 2719
MW 15.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...