SFRS9 (SRSF9) (NM_003769) Human 3' UTR Clone

CAT#: SC205274

3' UTR clone of splicing factor arginine/serine-rich 9 (SFRS9) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Cited in 1 publication.

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name SFRS9 (SRSF9) (NM_003769) Human 3' UTR Clone
Vector pMirTarget
Synonyms SFRS9; SRp30c
ACCN NM_003769
Insert Size 377 bp
Sequence Data
>SC205274 3’UTR clone of NM_003769
The sequence shown below is from the reference sequence of NM_003769. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CACTACTTCTCTCCTTTCAGGCCCTACTGAGACAGGTGATGGGAATTTTTTCTTTATTTTTTAGGTTAA
CTGAGCTGCTTTGTGCTCAGAATCTACATTCCAGATTGAGGATTTAGTGTCTTAGGAAATTTTTTTAAT
TTTTTTTTTTTAAAGAAGAAAAAAAACTACATAATTTCTACCAGGGCCATATTAGCAGTGAAACATTTT
AAACTGCAGAAATTGTGGTTTTGGTTCAGAAACAAGTTGTATATTTTTCACCCCTGATTATGGGAAAAA
AATCAGTTCTGTCTTTGTGGGTTGCTCTACTATGGAGATCAACAGTTACTGTGACTGAGTCGGCCCATT
CTGTTTAGAAATATATTTTAAATGTTTAGTAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_003769.3
Synonyms SFRS9; SRp30c
Summary The protein encoded by this gene is a member of the serine/arginine (SR)-rich family of pre-mRNA splicing factors, which constitute part of the spliceosome. Each of these factors contains an RNA recognition motif (RRM) for binding RNA and an RS domain for binding other proteins. The RS domain is rich in serine and arginine residues and facilitates interaction between different SR splicing factors. In addition to being critical for mRNA splicing, the SR proteins have also been shown to be involved in mRNA export from the nucleus and in translation. Two pseudogenes, one on chromosome 15 and the other on chromosome 21, have been found for this gene. [provided by RefSeq, Sep 2010]
Locus ID 8683
MW 15.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Documents

Customer Reviews 
Loading...