MELK (NM_014791) Human 3' UTR Clone

CAT#: SC205468

3' UTR clone of maternal embryonic leucine zipper kinase (MELK) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name MELK (NM_014791) Human 3' UTR Clone
Vector pMirTarget
Synonyms HPK38
ACCN NM_014791
Insert Size 375 bp
Sequence Data
>SC205468 3’UTR clone of NM_014791
The sequence shown below is from the reference sequence of NM_014791. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAAGACATCCTATCTAGCTGCAAGGTATAATTGATGGATTCTTCCATCCTGCCGGATGAGTGTGGGTGT
GATACAGCCTACATAAAGACTGTTATGATCGCTTTGATTTTAAAGTTCATTGGAACTACCAACTTGTTT
CTAAAGAGCTATCTTAAGACCAATATCTCTTTGTTTTTAAACAAAAGATATTATTTTGTGTATGAATCT
AAATCAAGCCCATCTGTCATTATGTTACTGTCTTTTTTAATCATGTGGTTTTGTATATTAATAATTGTT
GACTTTCTTAGATTCACTTCCATATGTGAATGTAAGCTCTTAACTATGTCTCTTTGTAATGTGTAATTT
CTTTCTGAAATAAAACCATTTGTGAATATA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_014791.4
Synonyms HPK38
Summary Serine/threonine-protein kinase involved in various processes such as cell cycle regulation, self-renewal of stem cells, apoptosis and splicing regulation. Has a broad substrate specificity; phosphorylates BCL2L14, CDC25B, MAP3K5/ASK1 and ZNF622. Acts as an activator of apoptosis by phosphorylating and activating MAP3K5/ASK1. Acts as a regulator of cell cycle, notably by mediating phosphorylation of CDC25B, promoting localization of CDC25B to the centrosome and the spindle poles during mitosis. Plays a key role in cell proliferation and carcinogenesis. Required for proliferation of embryonic and postnatal multipotent neural progenitors. Phosphorylates and inhibits BCL2L14, possibly leading to affect mammary carcinogenesis by mediating inhibition of the pro-apoptotic function of BCL2L14. Also involved in the inhibition of spliceosome assembly during mitosis by phosphorylating ZNF622, thereby contributing to its redirection to the nucleus. May also play a role in primitive hematopoiesis.[UniProtKB/Swiss-Prot Function]
Locus ID 9833
MW 14.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...