IL9R (NM_002186) Human 3' UTR Clone

CAT#: SC205745

3' UTR clone of interleukin 9 receptor (IL9R) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name IL9R (NM_002186) Human 3' UTR Clone
Vector pMirTarget
Synonyms CD129; IL-9R
ACCN NM_002186
Insert Size 438 bp
Sequence Data
>SC205745 3’UTR clone of NM_002186
The sequence shown below is from the reference sequence of NM_002186. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTCAGCAAGGCTCGGTCCTGGACATTCTAGGTCCCTGACTCGCCAGATGCATCATGTCCATTTTGGGAA
AATGGACTGAAGTTTCTGGAGCCCTTGTCTGAGACTGAACCTCCTGAGAAGGGGCCCCTAGCAGCGGTC
AGAGGTCCTGTCTGGATGGAGGCTGGAGGCTCCCCCCTCAACCCCTCTGCTCAGTGCCTGTGGGGAGCA
GCCTCTACCCTCAGCATCCTGGCCACAAGTTCTTCCTTCCATTGTCCCTTTTCTTTATCCCTGACCTCT
CTGAGAAGTGGGGTGTGGTCTCTCAGCTGTTCTGCCCTCATACCCTTAAAGGGCCAGCCTGGGCCCAGT
GGACACAGGTAAGGCACCATGACCACCTGGTGTGACCTCTCTGTGCCTTACTGAGGCACCTTTCTAGAG
ATTAAAAGGGGCTTGATGGCTGTT
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002186.3
Synonyms CD129; IL-9R
Summary The protein encoded by this gene is a cytokine receptor that specifically mediates the biological effects of interleukin 9 (IL9). The functional IL9 receptor complex requires this protein as well as the interleukin 2 receptor, gamma (IL2RG), a common gamma subunit shared by the receptors of many different cytokines. The ligand binding of this receptor leads to the activation of various JAK kinases and STAT proteins, which connect to different biologic responses. This gene is located at the pseudoautosomal regions of X and Y chromosomes. Genetic studies suggested an association of this gene with the development of asthma. Multiple pseudogenes on chromosome 9, 10, 16, and 18 have been described. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]
Locus ID 3581
MW 15.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...