TORC2 (CRTC2) (NM_181715) Human 3' UTR Clone

CAT#: SC206009

3' UTR clone of CREB regulated transcription coactivator 2 (CRTC2) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Cited in 1 publication.

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name TORC2 (CRTC2) (NM_181715) Human 3' UTR Clone
Vector pMirTarget
Synonyms TORC-2; TORC2
ACCN NM_181715
Insert Size 464 bp
Sequence Data
>SC206009 3’UTR clone of NM_181715
The sequence shown below is from the reference sequence of NM_181715. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAGTCATTCCGCAGTGACCGGCTCCAATGAGGGCACCTCATCACCATCCCTCTTCTTGGCCCCATCCCC
CACCACCATTCCTTTCCTCCCTTCCCCCTGGCAGGTAGAGACTCTACTCTCTGTCCCCAGATCCTCTTT
CTAGCATGAATGAAGGATGCCAAGAATGAGAAAAAGCAAGGGGTTTGTCCAGGTGGCCCCTGAATTCTG
CGCAAGGGATGGGCCTGGGGGAACTCAAGGGAGGGCCTAAAGCACTTGTAACTTTGAACCGTCTGTCTG
GAGGTCAGAGCCTGTTGGAAAGCAGGGGTAGAGGGGAGCCCTGGAAGCAGGGCTTTTCCGGATGCCTAG
GGGTGGGCAGTGCCAGCCCCTCCTCACCACTCTTCCCCTTGCAGTGGAGGAGAGAGCCAGAGTGGATAC
TATTTTTTATTAAATATATTATTATATGTTAATAAAAAAATCATATCAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_181715.3
Synonyms TORC-2; TORC2
Summary This gene encodes a member of the transducers of regulated cAMP response element-binding protein activity family of transcription coactivators. These proteins promote the transcription of genes targeted by the cAMP response element-binding protein, and therefore play an important role in many cellular processes. Under basal conditions the encoded protein is phosphorylated by AMP-activated protein kinase or the salt-inducible kinases and is sequestered in the cytoplasm. Upon activation by elevated cAMP or calcium, the encoded protein translocates to the nucleus and increases target gene expression. Single nucleotide polymorphisms in this gene may increase the risk of type 2 diabetes. A pseudogene of this gene is located on the long arm of chromosome 5. [provided by RefSeq, Dec 2010]
Locus ID 200186
MW 16.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Documents

Customer Reviews 
Loading...