Zyxin (ZYX) (NM_003461) Human 3' UTR Clone

CAT#: SC206061

3' UTR clone of zyxin (ZYX) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Cited in 1 publication.

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Zyxin (ZYX) (NM_003461) Human 3' UTR Clone
Vector pMirTarget
Synonyms ESP-2; HED-2
ACCN NM_003461
Insert Size 459 bp
Sequence Data
>SC206061 3’UTR clone of NM_003461
The sequence shown below is from the reference sequence of NM_003461. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AAGTGCCACACTGCTAGAGCCCAGACCTGAGTGAGGACAGGCCCTCTTCAGACCGCAGTCCATGCCCCA
TTGTGGACCACCCACACTGAGACCACCTGCCCCCACCTCAGTTATTGTTTTGATGTCTAGCCCCTCCCA
TTTCCAACCCCTCCCTAGCATCCCAGGTGCCCTGACCCAGGACCCAACATGGTCTAGGGATGCAGGATC
CCCGCCCTGGGGTCTGGTCCTCGCCCATCCTGCAGGGATTGCCCACCGTCTTCCAGACACCCCACCTGA
GGGGGGCACCAGGTTTAGTGCTGCTGCTTTCACTGCTGCACCCGCGCCCTCGGCCGGCCCCCCGAGCAG
CCTTTGTACTCTGCTTGCGGAGGGCTGGGAGACCCTCCAGGACATTCCCACCCTCCCCCATGCTGCCAA
GTTGTAGCTATAGCTACAAATAAAAAAAAACCTTGTTTTCCAGAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_003461.5
Synonyms ESP-2; HED-2
Summary Focal adhesions are actin-rich structures that enable cells to adhere to the extracellular matrix and at which protein complexes involved in signal transduction assemble. Zyxin is a zinc-binding phosphoprotein that concentrates at focal adhesions and along the actin cytoskeleton. Zyxin has an N-terminal proline-rich domain and three LIM domains in its C-terminal half. The proline-rich domain may interact with SH3 domains of proteins involved in signal transduction pathways while the LIM domains are likely involved in protein-protein binding. Zyxin may function as a messenger in the signal transduction pathway that mediates adhesion-stimulated changes in gene expression and may modulate the cytoskeletal organization of actin bundles. Alternative splicing results in multiple transcript variants that encode the same isoform. [provided by RefSeq, Jul 2008]
Locus ID 7791
MW 16.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Documents

Customer Reviews 
Loading...