OGG1 (NM_016821) Human 3' UTR Clone

CAT#: SC207237

3' UTR clone of 8-oxoguanine DNA glycosylase (OGG1) nuclear gene encoding mitochondrial protein transcript variant 2a for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name OGG1 (NM_016821) Human 3' UTR Clone
Vector pMirTarget
Synonyms HMMH; HOGG1; MUTM; OGH1
ACCN NM_016821
Insert Size 545 bp
Sequence Data
>SC207237 3’UTR clone of NM_016821
The sequence shown below is from the reference sequence of NM_016821. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GTGATGCAAGCCAGCTTACTAGCACTTTGAGAATGAGTCTCCTGTTGAGCTGGTAGGATGTAAGCCTGG
AGCTAATGGCGATCATCTTTGCCACCACCTGGGGAGAGCCTGCTTGGGAATGAAATTAACACAAAGGAA
GTCCAACCTGAGAAATGGCCAAATATATTTCCTGATAACATTATGTGGCCCTCTGGATCCAGCCATGCC
TGAGGTCTACCCCTGGGCTTTTGGATTATGTGTACAGTTGGTTCATCCCTTTTTCTGCTAATTCGAGTC
ATGGCTAATTTAACACCCTTTAGAACCTTAAAGAACCATCAGCATCACCCGGGAACTTTTTTAGAAATG
CAAAATCTCTACTGCTTTGGATCCTGGGTCAAAAAAAAGAAAAAAAAAAGAAATGCAAAACTTTAGGCC
CTGCCCCAGATTTACTAAATCAATCTGCAGTTTAACAAAATCCTCAGGTGATTTGTATGCTCATTGAAC
TTTAAGAAGCAGTGTTTTAGAACAGGTTCTTAAAAAGGAACAAATAAACTCATTTAACTAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_016821.3
Synonyms HMMH; HOGG1; MUTM; OGH1
Summary This gene encodes the enzyme responsible for the excision of 8-oxoguanine, a mutagenic base byproduct which occurs as a result of exposure to reactive oxygen. The action of this enzyme includes lyase activity for chain cleavage. Alternative splicing of the C-terminal region of this gene classifies splice variants into two major groups, type 1 and type 2, depending on the last exon of the sequence. Type 1 alternative splice variants end with exon 7 and type 2 end with exon 8. All variants share the N-terminal region in common, which contains a mitochondrial targeting signal that is essential for mitochondrial localization. Many alternative splice variants for this gene have been described, but the full-length nature for every variant has not been determined. [provided by RefSeq, Aug 2008]
Locus ID 4968
MW 20.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...