Cyclin E1 (CCNE1) (NM_001238) Human 3' UTR Clone

CAT#: SC207262

3' UTR clone of cyclin E1 (CCNE1) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Cited in 1 publication.

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Cyclin E1 (CCNE1) (NM_001238) Human 3' UTR Clone
Vector pMirTarget
Synonyms CCNE; pCCNE1
ACCN NM_001238
Insert Size 565 bp
Sequence Data
>SC207262 3’UTR clone of NM_001238
The sequence shown below is from the reference sequence of NM_001238. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AAGCAGAGCAGCGGGCCGGAAATGGCGTGACCACCCCATCCTTCTCCACCAAAGACAGTTGCGCGCCTG
CTCCACGTTCTCTTCTGTCTGTTGCAGCGGAGGCGTGCGTTTGCTTTTACAGATATCTGAATGGAAGAG
TGTTTCTTCCACAACAGAAGTATTTCTGTGGATGGCATCAAACAGGGCAAAGTGTTTTTTATTGAATGC
TTATAGGTTTTTTTTAAATAAGTGGGTCAAGTACACCAGCCACCTCCAGACACCAGTGCGTGCTCCCGA
TGCTGCTATGGAAGGTGCTACTTGACCTAAGGGACTCCCACAACAACAAAAGCTTGAAGCTGTGGAGGG
CCACGGTGGCGTGGCTCTCCTCGCAGGTGTTCTGGGCTCCGTTGTACCAAGTGGAGCAGGTGGTTGCGG
GCAAGCGTTGTGCAGAGCCCATAGCCAGCTGGGCAGGGGGCTGCCCTCTCCACATTATCAGTTGACAGT
GTACAATGCCTTTGATGAACTGTTTTGTAAGTGCTGCTATATCTATCCATTTTTTAATAAAGATAATAC
TGTTTTTGAGACA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001238.4
Synonyms CCNE; pCCNE1
Summary The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin forms a complex with and functions as a regulatory subunit of CDK2, whose activity is required for cell cycle G1/S transition. This protein accumulates at the G1-S phase boundary and is degraded as cells progress through S phase. Overexpression of this gene has been observed in many tumors, which results in chromosome instability, and thus may contribute to tumorigenesis. This protein was found to associate with, and be involved in, the phosphorylation of NPAT protein (nuclear protein mapped to the ATM locus), which participates in cell-cycle regulated histone gene expression and plays a critical role in promoting cell-cycle progression in the absence of pRB. [provided by RefSeq, Apr 2016]
Locus ID 898
MW 21
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Documents

Customer Reviews 
Loading...