AVPR V2 (AVPR2) (NM_001146151) Human 3' UTR Clone

CAT#: SC209872

3' UTR clone of arginine vasopressin receptor 2 (AVPR2) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name AVPR V2 (AVPR2) (NM_001146151) Human 3' UTR Clone
Vector pMirTarget
Synonyms ADHR; DI1; DIR; DIR3; NDI; NDI1; V2R
ACCN NM_001146151
Insert Size 760 bp
Sequence Data
>SC209872 3’UTR clone of NM_001146151
The sequence shown below is from the reference sequence of NM_001146151. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CCTCTGGAAGGTGGGTGTAGCCGTGGCTAGGGCTGACGGGGCCACTTGGGCTTGGCCGCATGCCCCTGT
GCCCCACCAGCCATCCTGAACCCAACCTAGATCCTCCACCTCCACAGGGGCGCCCTTTGTGCTACTCAT
GTTGCTGGCCAGCCTCAACAGCTGCACCAACCCCTGGATCTATGCATCTTTCAGCAGCAGCGTGTCCTC
AGAGCTGCGAAGCTTGCTCTGCTGTGCCCGGGGACGCACCCCACCCAGCCTGGGTCCCCAAGATGAGTC
CTGCACCACCGCCAGCTCCTCCCTGGCCAAGGACACTTCATCGTGAGGAGCTGTTGGGTGTCTTGCCTC
TAGAGGCTTTGAGAAGCTCAGCTGCCTTCCTGGGGCTGGTCCTGGGAGCCACTGGGAGGGGGACCCGTG
GAGAATTGGCCAGAGCCTGTGGCCCCGAGGCTGGGACACTGTGTGGCCCTGGACAAGCCACAGCCCCTG
CCTGGGTCTCCACATCCCCAGCTGTATGAGGAGAGCTTCAGGCCCCAGGACTGTGGGGGCCCCTCAGGT
CAGCTCACTGAGCTGGGTGTAGGAGGGGCTGCAGCAGAGGCCTGAGGAGTGGCAGGAAAGAGGGAGCAG
GTGCCCCCAGGTGAGACAGCGGTCCCAGGGGCCTGAAAAGGAAGGACCAGGCTGGGGCCAGGGGACCTT
CCTGTCTCCGCCTTTCTAATCCCTCCCTCCTCATTCTCTCCCTAATAAAAATTGGAGCTCATTTTCCACA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001146151.3
Synonyms ADHR; DI1; DIR; DIR3; NDI; NDI1; V2R
Summary This gene encodes the vasopressin receptor, type 2, also known as the V2 receptor, which belongs to the seven-transmembrane-domain G protein-coupled receptor (GPCR) superfamily, and couples to Gs thus stimulating adenylate cyclase. The subfamily that includes the V2 receptor, the V1a and V1b vasopressin receptors, the oxytocin receptor, and isotocin and mesotocin receptors in non-mammals, is well conserved, though several members signal via other G proteins. All bind similar cyclic nonapeptide hormones. The V2 receptor is expressed in the kidney tubule, predominantly in the distal convoluted tubule and collecting ducts, where its primary property is to respond to the pituitary hormone arginine vasopressin (AVP) by stimulating mechanisms that concentrate the urine and maintain water homeostasis in the organism. When the function of this gene is lost, the disease Nephrogenic Diabetes Insipidus (NDI) results. The V2 receptor is also expressed outside the kidney although its tissue localization is uncertain. When these 'extrarenal receptors' are stimulated by infusion of a V2 selective agonist (dDAVP), a variety of clotting factors are released into the bloodstream. The physiologic importance of this property is not known - its absence does not appear to be detrimental in NDI patients. The gene expression has also been described in fetal lung tissue and lung cancer associated with alternative splicing. [provided by RefSeq, Jul 2008]
Locus ID 554
MW 26.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...