LAMC2 (NM_018891) Human 3' UTR Clone

CAT#: SC210654

3' UTR clone of laminin gamma 2 (LAMC2) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name LAMC2 (NM_018891) Human 3' UTR Clone
Vector pMirTarget
Synonyms B2T; BM600; CSF; EBR2; EBR2A; LAMB2T; LAMNB2
ACCN NM_018891
Insert Size 925 bp
Sequence Data
>SC210654 3’UTR clone of NM_018891
The sequence shown below is from the reference sequence of NM_018891. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GACGGCCTCCTGCATCTGATGGGTATGTGAACCCACAACCCACAACCTTCCAGCTCCATGCTCCAGGGC
TTTGCTCCAGAACACTCACTATACCTAGCCCCAGCAAAGGGGAGTCTCAGCTTTCCTTAAGGATATCAG
TAAATGTGCTTTGTTTCCAGGCCCAGATAACTTTCGGCAGGTTCCCTTACATTTACTGGACCCTGTTTT
ACCGTTGCTAAGATGGGTCACTGAACACCTATTGCACTTGGGGGTAAAGGTCTGTGGGCCAAAGAACAG
GTGTATATAAGCAACTTCACAGAACACGAGACAGCTTGGGAATCCTGCTAAAGAGTCTGGCCTGGACCC
TGAGAAGCCAGTGGACAGTTTTAAGCAGAGGAATAACATCACCACTGTATATTTCAGAAAGATCACTAG
GGCAGCCGAGTGGAGGAAAGCTTGAAGAGGGGGTTAGAGAGAAGGCAGGTTGAGACTACTTAAGATATT
GTTGAAATAATTGAAGAGAGAAATGACAGGAGCCTGCTCTAAGGCAGTAGAATGGTGGCTGGGAAGATG
TGAAGGAAGATTTTCCCAGTCTGTGAAGTCAAGAATCACTTGCCGGCCGGGTGTGGTGGCTCACGCCTG
TAATTCTAGCACTTTGGGAGACTGAAGCGGGTGGATCACCCGAGGTCAGGAGTTGAAGACCAGCCTGGC
CAACATGGTGAAACCCTGTCTCTACTAAAAGTACAAAAATTAGCTGGATGTGGTGGTGGGCGCCTGTAA
TTCCAGCTACTCAGGAGTCTGAGGCAGGAGAATCGCTTGAACCCAGGAGGCGGAGGTTACAGTGAGCCA
AGATTGCACCACTGCTCTCCAGCCTGGGGAACAGAGCAAGACTGTCTCAAAAAAAAAAAAAAAAGGAAA
AATAAAAAAGAATCACTTGCCGATTTTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_018891.3
Synonyms B2T; BM600; CSF; EBR2; EBR2A; LAMB2T; LAMNB2
Summary Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins, composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively), have a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the gamma chain isoform laminin, gamma 2. The gamma 2 chain, formerly thought to be a truncated version of beta chain (B2t), is highly homologous to the gamma 1 chain; however, it lacks domain VI, and domains V, IV and III are shorter. It is expressed in several fetal tissues but differently from gamma 1, and is specifically localized to epithelial cells in skin, lung and kidney. The gamma 2 chain together with alpha 3 and beta 3 chains constitute laminin 5 (earlier known as kalinin), which is an integral part of the anchoring filaments that connect epithelial cells to the underlying basement membrane. The epithelium-specific expression of the gamma 2 chain implied its role as an epithelium attachment molecule, and mutations in this gene have been associated with junctional epidermolysis bullosa, a skin disease characterized by blisters due to disruption of the epidermal-dermal junction. Two transcript variants resulting from alternative splicing of the 3' terminal exon, and encoding different isoforms of gamma 2 chain, have been described. The two variants are differentially expressed in embryonic tissues, however, the biological significance of the two forms is not known. Transcript variants utilizing alternative polyA_signal have also been noted in literature. [provided by RefSeq, Aug 2011]
Locus ID 3918
MW 34.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...