ABCB9 (NM_203444) Human 3' UTR Clone

CAT#: SC211228

3' UTR clone of ATP-binding cassette sub-family B (MDR/TAP) member 9 (ABCB9) transcript variant 4 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name ABCB9 (NM_203444) Human 3' UTR Clone
Vector pMirTarget
Synonyms EST122234; TAPL
ACCN NM_203444
Insert Size 305 bp
Sequence Data
>SC211228 3’UTR clone of NM_203444
The sequence shown below is from the reference sequence of NM_203444. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCCGAGAGCGAGTATCTGTGTGCTGGGTAAACCAGGAGAAAGTAATTGCAGTCGAGGGCTTTGGGAACA
GCACAGTTGGCCAGAGAGACAGATGAGGAAAACAAGCAGGGATGAGAGAGAATGAAGAGGAGCACGGCA
CCCCAGGGCTGGCTTAGTCCTGGCGCCAGGACTTAGTTTACTCTGTCATTGTTTCTTTCCCACATTAGA
GTTTGTCTTCATCACTGCTGTATTCCCCAGTGCCTAGAACAGTGGCTGACACATAGTATGTGCTCAGTA
AACAGCCATTAAAGAAATGTTTGAGCTGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_203444.4
Synonyms EST122234; TAPL
Summary The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance as well as antigen presentation. This family member functions in the translocation of peptides from the cytosol into the lysosomal lumen. Alternative splicing of this gene results in distinct isoforms which are likely to have different substrate specificities. [provided by RefSeq, Jul 2011]
Locus ID 23457
MW 11.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...