Abhd12 (NM_024465) Mouse Untagged Clone

CAT#: MC200091

Abhd12 (untagged) - Mouse abhydrolase domain containing 12 (Abhd12), (10ug)



  "NM_024465" in other vectors (4)

CNY 2,400.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Abhd12 Antibody - C-terminal region
    • 50 ug

CNY 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 1500011G07Rik; 6330583M11Rik; AI431047; AW547313
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC002263 sequence for NM_024465
GCCTATTGACGGTACCCGAGAGTGTCTGCTGCCCTGTGTGGTAAAGCATCATCCTGACAGGTGCTGAGTT CCCTTGGCTACCACGTGGTCACCTTTGACTACAGAGGTTGGGGTGACTCAGTAGGAACACCATCGGAGCG AGGCATGACGTATGACGCACTCCATGTTTTTGACTGGATCAAAGCAAGAAGTGGTGATAATCCTGTGTAT ATTTGGGGCCATTCACTGGGCACCGGAGTGGCAACAAATCTGGTACGGCGCCTCTGTGAGCGAGAGACGC CACCAGATGCCCTTATATTGGAGTCTCCATTCACAAATATTCGTGAAGAAGCAAAGAGTCATCCATTTTC AGTGATATACCGATACTTCCCTGGCTTTGACTGGTTCTTCCTCGACCCCATTACAAGCAGTGGAATTAAA TTTGCAAATGACGAAAATATGAAGCACATCTCCTGCCCTCTGCTCATCTTGCATGCCGAGGATGATCCAG TTGTGCCCTTTCATCTCGGTAGAAAGCTATACAACATTGCTGCGCCATCTCGAAGTTTCCGAGACTTCAA AGTCCAGTTTATCCCCTTTCACTCAGACCTTGGCTACAGACATAAATACATCTACAAGAGCCCAGAGCTT CCAAGGATACTGAGGGAATTCCTAGGGAAGTCGGAACCGGAACGCCAGCACTGAGACCGGCCCATGAAGG AGCATGAAGACCCACCTTCCTTCCTTCTCCCCTGGACAGCAGTCTGGCACCCAGAAGCCCAGAGTGCCAC CACCTGTGGTGCTCAGGAGCCCAGTGCACACCTAGAAAGAGGACTCAGACACAGCGGGCAGAGGCTCCTG ATGGATCTGTGAGGAAAACCCGGTGGCAGGCAGGTGGCCCCCCCAGCCCTCTGGTGACCACTGTATCTGA GCTCTTTTTGGGAAGGCTTATAGACAGCAGGTGGACCCCATATGCTGGGCATAGGGAGCCTGGGAAGGGC TCAGGAGCTCAGGACCACTCCAGGCTCTCTGGCACCATTGCTTAAGATTCAGGAAAATGGTTCTTTCTGC CCTTCCTAGCGTTTACAGAACAGACTCCAAGTGGTTCAGTTTGTCTCCTACAGCTCATTTACCTGCTTGC CTTCCTCAGCTGTCCCTGCCTCTCCTGGCATCTGATTACCCACAGTAAGGGGCACCTGGATCTGCACTTC TTCCATTCTGCCCACCTGTCTGTCACCTAACCTGGCCGTAGACTGAGCATTTATTTAAGAATAAAATCTC GGTGGTGGTCTATTTATTGTTTTCTCTACAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_024465
Insert Size 540 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC002263, AAH02263
RefSeq Size 1304 bp
RefSeq ORF 540 bp
Locus ID 76192
UniProt ID Q99LR1
Gene Summary Lysophosphatidylserine (LPS) lipase that mediates the hydrolysis of lysophosphatidylserine, a class of signaling lipids that regulates immunological and neurological processes (PubMed:23297193, PubMed:25580854, PubMed:30420694). Represents a major lysophosphatidylserine lipase in the brain, thereby playing a key role in the central nervous system (PubMed:23297193). Also able to hydrolyze oxidized phosphatidylserine; oxidized phosphatidylserine is produced in response to severe inflammatory stress and constitutes a proapoptotic 'eat me' signal (PubMed:30643283). Also has monoacylglycerol (MAG) lipase activity: hydrolyzes 2-arachidonoylglycerol (2-AG), thereby acting as a regulator of endocannabinoid signaling pathways (PubMed:18096503). Has a strong preference for very-long-chain lipid substrates; substrate specificity is likely due to improved catalysis and not improved substrate binding (PubMed:30237167).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) encodes the longest isoform (1). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...