United States
Germany
Japan
United Kingdom
China
Svbp (NM_024462) Mouse Untagged Clone
CAT＃: MC200194
Ccdc23 (untagged) - Mouse coiled-coil domain containing 23 (Ccdc23), transcript variant 2, (10ug)
CNY 1,200.00
CNY 2,000.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 2410005K17Rik; AI851162; Ccdc23 |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC002274 sequence for NM_024462
CGGACGCGTGGGCGCGGAAGGGGGGAGCTAGGGTGAACCCCGCGTGGGGGCTTGTCTACGACGTGGCGGA GGCCGTGAGCCCGAGGCCGGGTCAGAGCTAACCAAGAAGCATTCAGAAGCCAAACCATGGATCCACCTGC CCGGAAAGAAAAATCCAAAGTTAAAGAACCAGCCTTCAGAGTGGAGAAGGCTAAGCAGAAATCTGCCCAG CAGGAGCTGAAGCAAAGACAGAGAGCAGAGATCTATGCTCTCAACAGAGTCATGACGGAGCTGGAGCAGC AGCAGTTTGATGAGTTCTGTAAGCAGATGCAGCCGCCTGGGGAGTGAGCCAGCCTGCATCCCCGGCAGAG GAACTGGTGCCTGCCTTTGTCTGTGAGCTCATTCCCACTGTTACCCTGAGCTGGCCCAATGGAGCCTTAC AGAACTAATCAGGACTTGTGGAGACCTCTGCACTGAACTTCCTATAAGTAACTTCCACCACACTGGTTTC TACTCTCAGAACTGCCCCAGTGCTTGCTGGGTAGACTTTTCATCTAAGACAGTGGATTTTTCAAAAAGAC CTTTTTTCTATTGTTTGAGAAAAATCATTGTTTCTTGTGAAACTGCGTGTCTTCCCTAAAAATAATAAAA TTCAGAAATGTTAAAAAAAAAAAAAAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_024462 |
| Insert Size | 201 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC002274, AAH02274 |
| RefSeq Size | 659 bp |
| RefSeq ORF | 201 bp |
| Locus ID | 69216 |
| UniProt ID | Q99LQ4 |
| Gene Summary | Enhances the tyrosine carboxypeptidase activity of VASH1 and VASH2, thereby promoting the removal of the C-terminal tyrosine residue of alpha-tubulin (PubMed:29146868). Also required to enhance the solubility and secretion of VASH1 and VASH2 (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) represents use of an alternate promoter and 5' UTR and uses a downstream start codon, compared to variant 1. The resulting isoform (b) has a shorter N-terminus, compared to isoform a. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MR200054 | Ccdc23 (Myc-DDK-tagged) - Mouse coiled-coil domain containing 23 (Ccdc23), transcript variant 2 |
CNY 1,200.00 |
|
| MR200054L3 | Lenti ORF clone of Ccdc23 (Myc-DDK-tagged) - Mouse coiled-coil domain containing 23 (Ccdc23), transcript variant 2 |
CNY 4,750.00 |
|
| MR200054L4 | Lenti ORF clone of Ccdc23 (mGFP-tagged) - Mouse coiled-coil domain containing 23 (Ccdc23), transcript variant 2 |
CNY 4,750.00 |
