Snrpc (NM_011432) Mouse Untagged Clone
CAT#: MC200267
Snrpc (untagged) - Mouse U1 small nuclear ribonucleoprotein C (Snrpc), (10ug)
CNY 1,200.00
CNY 2,000.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | Snrp1c; U1-C; U1C |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC008243 sequence for NM_011432
GGCGGCGGGGATCGGGGTAGCCAACGGCTTGTGGAGCATCATGCCCAAGTTTTATTGTGACTACTGTGAT ACGTATCTTACCCACGATTCTCCATCTGTGAGGAAGACACACTGCAGTGGTCGGAAACACAAAGAGAATG TGAAAGACTATTATCAGAAATGGATGGAAGAGCAGGCCCAGAGCCTGATTGACAAGACAACGGCTGCATT TCAACAAGGGAAGATCCCTCCTGCTCCGTTCTCTGCTCCTCCGCCTGCAGGGGCCATGATCCCACCTCCC CCCAGTCTCCCGGGCCCTCCTCGGCCTGGCATGATGCCTGCCCCCCACATGGGAGGCCCTCCCATGATGC CAATGATGGGCCCCCCTCCGCCCGGAATGATGCCCGTGGGACCAGCTCCTGGGATGAGACCACCCATGGG AGGCCACATGCCCATGATGCCCGGACCTCCCATGATGAGACCTCCTGCCCGCCCTATGATGGTGCCCACC CGGCCTGGCATGACCCGGCCAGACAGATAAGAGCAGAAGCGCTCTTGATGGTTTTGTATTTCTTGTTCTG TTCCACCAGGAGCTCTTGGTGCTGAGCCCGAGTGTTTACTAGATGCATGGAAAGGAAACTTCCCTTCCTA ACTGAATATTTTTGGAGGGAGAAATAATACAAAAAAGTGCAGTTTTCACTTATATTGTGAAATGTGAAAA TAAAGTCATCAGCTCTTTTAGTTAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_011432 |
Insert Size | 480 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC008243, AAH08243 |
RefSeq Size | 738 bp |
RefSeq ORF | 480 bp |
Locus ID | 20630 |
UniProt ID | Q62241 |
Gene Summary | Component of the spliceosomal U1 snRNP, which is essential for recognition of the pre-mRNA 5' splice-site and the subsequent assembly of the spliceosome. SNRPC/U1-C is directly involved in initial 5' splice-site recognition for both constitutive and regulated alternative splicing. The interaction with the 5' splice-site seems to precede base-pairing between the pre-mRNA and the U1 snRNA. Stimulates commitment or early (E) complex formation by stabilizing the base pairing of the 5' end of the U1 snRNA and the 5' splice-site region.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG201213 | Snrpc (tGFP-tagged) - Mouse U1 small nuclear ribonucleoprotein C (Snrpc) |
CNY 2,850.00 |
|
MR201213 | Snrpc (Myc-DDK-tagged) - Mouse U1 small nuclear ribonucleoprotein C (Snrpc) |
CNY 1,200.00 |
|
MR201213L3 | Lenti ORF clone of Snrpc (Myc-DDK-tagged) - Mouse U1 small nuclear ribonucleoprotein C (Snrpc) |
CNY 4,750.00 |
|
MR201213L4 | Lenti ORF clone of Snrpc (mGFP-tagged) - Mouse U1 small nuclear ribonucleoprotein C (Snrpc) |
CNY 4,750.00 |