Bsg (NM_001077184) Mouse Untagged Clone
CAT#: MC200670
Bsg (untagged) - Mouse basigin (Bsg), transcript variant 2, (10ug)
CNY 3,600.00
Cited in 1 publication. |
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | AI115436; AI325119; CD147; EMMPRIN; HT-7 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC010270 sequence for NM_001077184
GACATGGCGGCGGCGCTGCTGCTGGCGCTGGCCTTCACGCTCTTGAGCGGCCAAGGCGCCTGCGCGGCGG CGGGCACCATCCAAACCTCGGTCCAGGAAGTCAACTCCAAAACACAGCTTACCTGCTCTTTGAACAGCAG TGGCGTTGACATCGTTGGCCACCGCTGGATGAGAGGTGGCAAGGTACTGCAGGAGGACACTCTGCCCGAC CTGCATACGAAGTACATAGTGGACGCAGATGACCGCTCTGGGGAATATTCCTGCATCTTCCTTCCTGAGC CTGTGGGCAGAAGCGAGATCAATGTGGAAGGGCCACCCAGGATCAAGGTCGGAAAGAAATCAGAGCATTC CAGTGAGGGAGAGCTTGCGAAACTGGTCTGCAAGTCCGATGCATCCTACCCTCCTATTACAGATTGGTTC TGGTTTAAGACCTCTGACACTGGGGAAGAAGAGGCAATCACCAATAGCACTGAAGCCAATGGCAAGTATG TGGTGGTATCCACGCCTGAGAAGTCACAGCTGACCATCAGCAACCTTGACGTAAATGTTGACCCTGGCAC CTACGTGTGTAATGCCACCAACGCCCAGGGCACTACTCGGGAAACCATCTCACTGCGTGTGCGGAGCCGC ATGGCAGCCCTCTGGCCCTTCCTAGGCATCGTGGCTGAGGTCCTGGTGTTGGTTACCATCATCTTTATCT ATGAGAAGAGGCGGAAGCCAGACCAGACCCTGGACGAGGATGACCCTGGCGCCGCCCCACTGAAGGGCAG TGGAACTCACATGAATGACAAGGACAAGAATGTACGCCAGAGGAACGCCACCTGAGTGGTGGGGCAGGCG GGGGAGGGGAGGTGCCCAGGGTGCCTGACCCCAGGCCAGCGTCTACCTCCACTCCAGTATCCCATCCTGT CCCAATTTGAACCTACCCAACCCAACCTATCCCAACCCAAGTGAAGACAGAGCCTTACCTTACAGAAAAC CCACCTGGAAGAAGCAAGCCACTTGCAGCCCCTGTTTCTAATTTAAACTAAATGAGGTTTCTATGCAGAC AATCCATTCCTTAGGGGTTTATGTTTTTATTTTTCCTTCCCTTCTGAAGTGTTGTCACTACAGCCCTGTG GAGTGGGGGAATGGGGCCTTGTCCTTGGTCAGGAGGGAAGGCCAGCGCATGCTCTGACTTACTGTTGGAG GGGGCTGGGCCTGCTGGAACCCCCCCAAATAAAGACCTACCCCACCAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_001077184 |
Insert Size | 822 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC010270, AAH10270 |
RefSeq Size | 1287 bp |
RefSeq ORF | 822 bp |
Locus ID | 12215 |
UniProt ID | P18572 |
Gene Summary | Plays an important role in targeting the monocarboxylate transporters SLC16A1, SLC16A3, SLC16A8, SLC16A11 and SLC16A12 to the plasma membrane. Plays pivotal roles in spermatogenesis, embryo implantation, neural network formation and tumor progression. Stimulates adjacent fibroblasts to produce matrix metalloproteinases (MMPS). Seems to be a receptor for oligomannosidic glycans. In vitro, promotes outgrowth of astrocytic processes.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 5' coding region, compared to variant 1. The resulting isoform (2) has a shorter N-terminus when compared to isoform 1. |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
MGAT1 and Complex N-Glycans Regulate ERK Signaling During Spermatogenesis
,Biswas, B;Batista, F;Sundaram, S;Stanley, P;,
Sci Rep
,PubMed ID 29386567
[BSG]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG225906 | Bsg (tGFP-tagged) - Mouse basigin (Bsg) transcript variant 2, (10ug) |
CNY 5,200.00 |
|
MR225906 | Bsg (Myc-DDK-tagged) - Mouse basigin (Bsg), transcript variant 2 |
CNY 3,600.00 |
|
MR225906L3 | Lenti ORF clone of Bsg (Myc-DDK-tagged) - Mouse basigin (Bsg), transcript variant 2 |
CNY 5,890.00 |
|
MR225906L4 | Lenti ORF clone of Bsg (mGFP-tagged) - Mouse basigin (Bsg), transcript variant 2 |
CNY 6,000.00 |